Wikipedia:Typo Team/moss/Old case notes
Appearance
< Wikipedia:Typo Team | moss
Case notes (B) from 2019-11-20 dump (partial)
[edit]T1+ case notes from 2019-11-20 dump
[edit]- Belukurichi - wikt:katthi - pichuva katthi (a hunter's dagger)
- 3 - BNC (software) - wikt:ezbounces, wikt:cubnc (probably OK: wikt:dircproxy): all software product jargon. Ira Leviton (talk) 22:09, 10 December 2019 (UTC)
- 1 - BX Plastics - wikt:lactoid: a product that was made by this company. I'm not sure if it should be capitalized, can't find any info on it. Ira Leviton (talk) 22:09, 10 December 2019 (UTC)
- 1 - Bag - wikt:bʰak: showing pronunciation. Ira Leviton (talk) 22:57, 10 December 2019 (UTC)
- 1 - Bagnoles-de-l'Orne - wikt:curists: people who believe in the curative power of spas. Ira Leviton (talk) 22:57, 10 December 2019 (UTC)
- 1 - Balearic dialect - wikt:you: showing proper grammar. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 1 - Baluan-Pam language - wikt:you: showing grammar. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 2 - Bambera - wikt:you, wikt:your: translation of poetry. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 58 - Bang! (card game) - wikt:Fargo(only, wikt:turn(but, wikt:it's, wikt:doesn't, wikt:you, wikt:you, wikt:you, wikt:you, wikt:your, wikt:you, wikt:you, wikt:you, wikt:your, wikt:your, wikt:your, wikt:your, wikt:you, wikt:you, wikt:your, wikt:your, wikt:you, wikt:you, wikt:you, wikt:your, wikt:you, wikt:you, wikt:you, wikt:you, wikt:your, wikt:you, wikt:you, wikt:you, wikt:charactes, wikt:your, wikt:you, wikt:your, wikt:you, wikt:your, wikt:your, wikt:your, wikt:you, wikt:your, wikt:you, wikt:your, wikt:your, wikt:your, wikt:your, wikt:you, wikt:you, wikt:you, wikt:your, wikt:you, wikt:your, wikt:you, wikt:your, wikt:your, wikt:you, wikt:your: this article needs a rewrite, and I indicated that with a tag. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 1 - Bardhaman - wikt:deuls: a type of temple in India (plural). Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 2 - Barranquenho - wikt:cruh, wikt:olivareh: both written this way to show pronunciation. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 1 - Barred parakeet - wikt:creamino: a local name for the white type of this parakeet. Ira Leviton (talk) 18:12, 7 December 2019 (UTC)
- 1 - Basilica of San Domenico - wikt:protogothic; seems OK. Ira Leviton (talk) 04:19, 3 December 2019 (UTC)
- 1 - Bassinthedust - wikt:elebrity: written deliberately as $elebrity. Ira Leviton (talk) 04:19, 3 December 2019 (UTC)
- 1 - Basudev Than - wikt:tʱan: attempting to show pronunciation. Ira Leviton (talk) 04:19, 3 December 2019 (UTC)
- 1 - Bates distribution - wikt:sgn(nx: part of a mathematical formula. Ira Leviton (talk) 04:19, 3 December 2019 (UTC)
- 1 - Battlement - wikt:carnels: apparently an arcane alternative for crenels. Ira Leviton (talk) 16:32, 5 December 2019 (UTC)
- 1 - Be.A - wikt:rtist: part of a band name. Ira Leviton (talk) 02:22, 6 December 2019 (UTC)
- 1 - Behavior mutation - wikt:shibire: a genetics term or name. Ira Leviton (talk) 19:50, 7 December 2019 (UTC)
- 1 - Bella Donna (comics) - wikt:it's: I'm not sure why this was flagged, it looks like it's the tail end of "Gambit's", after a character in this comic. Ira Leviton (talk) 00:12, 8 December 2019 (UTC)
- 5 - Bellerophontida - wikt:cyrtiform: an arcane term in the study of mollusks. Ira Leviton (talk) 00:12, 8 December 2019 (UTC)
- 1 - Belvedere Tiburon Library - wikt:jumpies: a type of ride at carnivals, maybe a regional word. Ira Leviton (talk) 00:12, 8 December 2019 (UTC)
- 1 - Bemalambdidae - wikt:connated: an arcane biology term. Ira Leviton (talk) 00:12, 8 December 2019 (UTC)
- 2 - Benwick - wikt:ravag: written deliberately as "ravag'd". Ira Leviton (talk) 02:15, 9 December 2019 (UTC)
- 2 - Benjamin Boothby - wikt:rederick, wikt:oseph: written deliberately as F(rederick) and J(oseph). Ira Leviton (talk) 02:15, 9 December 2019 (UTC)
- 1 - Berwick Area School District - wikt:of .75: part of a mathematical formula. Ira Leviton (talk) 22:27, 9 December 2019 (UTC)
- 1 - Beşparmak Mountains - wikt:bivergent: probably not a real word, used on this page to describe something that diverges in two ways. Ira Leviton (talk) 02:23, 13 December 2019 (UTC)
- 1 - Bhagwan Lal Indraji - (probably OK: wikt:nanghat) - changed to nanaghat Strickesel (talk)
- 1 - Bhairavi (thaat) - wikt:thaats - not a typo Strickesel (talk)
- 2 - Bhakri - wikt:nachni, wikt:bhakhris - not typos Strickesel (talk)
- 1 - Bheemdatta - wikt:bhashi - the name of a place Strickesel (talk)
- 1 - Bhikari Bal - wikt:pauthi - part of the name of a song Strickesel (talk)
- 1 - Bhimdatta Panta - wikt:you - in the translation of a phrase Strickesel (talk)
- 1 - Bhira Kheri - wikt:smrati - possibly the name of a college Strickesel (talk)
- 1 - Bhitauli - wikt:mazaars - seems to be a word for tomb Strickesel (talk)
- 3 - Big Brother (British TV series) - wikt:how's: this appears as "show's". I'm not sure why it was detected. Ira Leviton (talk) 19:55, 11 December 2019 (UTC)
- 4 - Big Brother Brasil 14 - wikt:how's: ditto. Ira Leviton (talk) 22:44, 11 December 2019 (UTC)
- 3 - Big-headed pantanal swamp turtle - wikt:pect, wikt:plastra: the first is unclear but intentional (needs explanation in the article), the second is the plural of plastron, part of a turtle shell.
- 5 - Bikini variants - wikt:hikini: a variant style of bikini. Ira Leviton (talk) 19:55, 11 December 2019 (UTC)
- 8 - Bilingual pun - wikt:don't, wikt:you're, wikt:eltin, wikt:you, wikt:your, wikt:you, wikt:you, wikt:you: these are all translations or to show pronunciation. Ira Leviton (talk) 22:44, 11 December 2019 (UTC)
- 5 - Bintulu - wikt:precondensate: chemistry jargon. Ira Leviton (talk) 22:44, 11 December 2019 (UTC)
- 1 - Bison hunting - wikt:Big .50s: a type of gun (plural). Ira Leviton (talk) 22:44, 11 December 2019 (UTC)
- 3 - Blue-headed racket-tail - wikt:kinawihan: a local name for the subject of the page. Ira Leviton (talk) 03:43, 10 December 2019 (UTC)
- 1 - Blumentopf - wikt:raportage: not a real word, but used by the artist of the page. Ira Leviton (talk) 03:43, 10 December 2019 (UTC)
- 1 - Boletus auripes - (probably OK: wikt:pseudocystidia): an anatomic part of the fungus. Ira Leviton (talk) 19:31, 11 December 2019 (UTC)
- 3 - Bolixo - wikt:tlmp: software jargon. Ira Leviton (talk) 19:31, 11 December 2019 (UTC)
- 8 - Bombyx mori - wikt:chawkie, wikt:chawkie, wikt:chawkie, wikt:chawkie: a larval form of this Bombyx. Ira Leviton (talk) 19:31, 11 December 2019 (UTC)
- 2 - Brasiliense Futebol Clube - wikt:candangos (+ sing.) - add to Wikt
- 5 - Brasília - wikt:superquadras (+ sing.) - add to Wikt
- 1 - Breakfast (Philippine TV program) - wikt:reakfast: written deliberately as B(reakfast). Ira Leviton (talk) 02:54, 10 December 2019 (UTC)
- 3 - Breusch–Godfrey test - wikt:lmtest, wikt:bgodfrey, (probably OK: wikt:bgtest): all software jargon. Ira Leviton (talk) 02:54, 10 December 2019 (UTC)
- 1 - Buncrana - wikt:metadolerite - add to Wikt
TS+DOT+ case notes from 2019-11-20 dump
[edit]- 2 - B. Russell Murphy - wikt:finished .500, wikt:a .500: winning percentages, used correctly. Ira Leviton (talk) 03:19, 13 December 2019 (UTC)
- 9 - B. V. S. Ravi - wikt:Varma,Puri, wikt:Jagannath,Krishna, wikt:Vamsi,Rana, wikt:Daggubati,Allu, wikt:Arjun,Ravi, wikt:Teja,Dil, wikt:Raju,Mohan, wikt:Babu,Manchu, wikt:Ready .He
- 1 - BC Lions - wikt:played .500: winning percentage, used correctly. Ira Leviton (talk) 19:59, 13 December 2019 (UTC)
- 2 - BD−22 5866 - wikt:most .04, wikt:most .26: precise decimal measures. Does 0 have to precede these? Ira Leviton (talk) 19:59, 13 December 2019 (UTC)
- 4 - Bacterial oxidation - wikt:iron(III, wikt:iron(III, wikt:iron(III, wikt:iron(III: chemistry terminology. Ira Leviton (talk) 21:22, 13 December 2019 (UTC)
- 1 - Bad Griesbach (Rottal) - wikt:i.Rottal: German-style abbreviation, without a space. Ira Leviton (talk) 21:52, 13 December 2019 (UTC)
- 1 - Bahraini dinar - wikt:abbreviated .د: seems to have inadvertently missed an Arabic letter. Ira Leviton (talk) 22:05, 28 December 2019 (UTC)
- 1 - Balika Vadhu - wikt:nuotaka: a word from a language on the Indian subcontinent but I can't tell which. Ira Leviton (talk) 03:12, 29 December 2019 (UTC) \\ prbably Hindi (nuotaka is part of a show title, that show is in Hindi) Xurizuri (talk) 14:25, 30 December 2020 (UTC)
- 19 - Balinese textiles - wikt:otonin, wikt:bebali, wikt:bebali, wikt:cenana, wikt:membah, wikt:bebali, wikt:bebali (probably OK: wikt:polèng, wikt:cepuk, wikt:predana, wikt:cepuk, wikt:gerinsing, wikt:geringseng, wikt:tumpal, wikt:ancur, wikt:songkèt, wikt:songkèt, wikt:metatah): these are in italics, but I can't tell which language with certainty. Ira Leviton (talk) 03:12, 29 December 2019 (UTC) \\ the languages of Balinese people are Balinese, Sasak, and Indonesian. We'd need to get speakers to rule out/in what language they are. Xurizuri (talk) 14:25, 30 December 2020 (UTC)
- 1 - Baltimore Bandits - wikt:playing .500: winning percentage. Ira Leviton (talk) 15:38, 29 December 2019 (UTC)
- 2 - Bangalore Fort - wikt:hoblis, wikt:varahas: a language from the Indian subcontinent, but I can't tell which. Ira Leviton (talk) 15:38, 29 December 2019 (UTC) \\ It's probably Kannada (but there's definitely room for uncertainty). they may also be terms that are copied over to English when referring to those items Xurizuri (talk) 14:25, 30 December 2020 (UTC)
- 2 - Bangarh - wikt:XI,II, wikt:Uma(Usha: written as Uma(Usha?)vana to show uncertanty of a name. Ira Leviton (talk) 15:38, 29 December 2019 (UTC)
- 1 - Barbara Stevens (basketball) - wikt:the .500: winning percentage. Ira Leviton (talk) 20:34, 29 December 2019 (UTC)
- 1 - Barcelona Dragons - wikt:a .500: winning percentage. Ira Leviton (talk) 20:34, 29 December 2019 (UTC)
- 6 - Battle of Al Hudaydah - wikt:there's, wikt:here's, wikt:won't, wikt:didn't, wikt:doesn't, wikt:territories.The: this is a fully protected page; I made a request for administrators to make the edits. Ira Leviton (talk) 02:05, 27 December 2019 (UTC)
- 8 - Batwoman - (probably OK: wikt:retconed). Retcon is a noun, but probably not a verb. I requested a clarification. Ira Leviton (talk) 20:43, 26 December 2019 (UTC)
- 1 - Bearded seal - wikt:oogrook: this is an Inuit word, but Intuit languages don't have ISO 693 codes so I don't know how to give it the proper language tag. Ira Leviton (talk) 19:01, 26 December 2019 (UTC)
- 4 - Beckmann rearrangement - wikt:haloimines, wikt:haloimines, wikt:nitrillium: chemical names. Ira Leviton (talk) 19:01, 26 December 2019 (UTC)
- 2 - Bedlam Theatre - wikt:how's: part of "show's" was detected. Ira Leviton (talk) 02:33, 26 December 2019 (UTC)
- 8 - Belousov–Zhabotinsky reaction - wikt:ruthenium(II, wikt:cerium(IV, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV: chemistry terminology.
Bet-Boa
[edit]- 1 - Beth Gibbons - wikt:in .O: ".O rang" is the name of a band. Ira Leviton (talk) 16:44, 25 December 2019 (UTC)
- 2 - Beth Lapides - wikt:unhomophobic, wikt:unhacky: terms used by the subject of the age. Ira Leviton (talk) 16:44, 25 December 2019 (UTC)
- 1 - Beth Nolan - wikt:K7 .E645: I marked it with a clarify tag, it's jargon. Ira Leviton (talk) 16:44, 25 December 2019 (UTC)
- 1 - Bethany LeSueur - wikt:a .910: winning percentage. Ira Leviton (talk)
- 2 - Bettiah Raj - wikt:mallikana, wikt:quanungoi: unclear language, from the Indian subcontinent. Ira Leviton (talk) 16:44, 25 December 2019 (UTC)
- 4 - Bigg Boss (Hindi season 3) - wikt:performances(ref, wikt:it's: seems to be part of "Rohit's" which is OK. Ira Leviton (talk) 22:46, 15 December 2019 (UTC)
- 1 - Bill Berrier - wikt:of .675: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Berry (basketball) - wikt:over .500: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Carmody - wikt:a .500: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Decker - wikt:of .696: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Dietrich - wikt:to .500: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Fennelly - wikt:a .758: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Greiner - wikt:was .500: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Lochead - wikt:a .520: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Muckalt - wikt:a .950; goalie save percentage. Ira Leviton (talk) 03:19, 13 December 2019 (UTC)
- 2 - Bill Musselman - wikt:a .845, wikt:a .656: winning percentages. Ira Leviton (talk) 03:19, 13 December 2019 (UTC)
- 2 - Bill Norman (football manager) - wikt:a .3768: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Sharman - wikt:than .400: shooting percentage. Ira Leviton (talk) 03:19, 13 December 2019 (UTC)
- 1 - Bill Sharsig - wikt:a .524: winning percentage. Ira Leviton (talk) 03:19, 13 December 2019 (UTC)
- 1 - Bill Tierney - wikt:of .750: winning percentage. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 1 - Bill Woodcock - wikt:the .ORG: software jargon. Ira Leviton (talk) 20:22, 14 December 2019 (UTC)
- 5 - Billings Outlaws - wikt:a .500: winning percentage. Ira Leviton (talk) 21:42, 14 December 2019 (UTC)
- 1 - Billy Gillispie - wikt:finish .500: winning percentage.
- 3 - Billy Murray (baseball) - wikt:of .585: winning percentage. Ira Leviton (talk) 21:42, 14 December 2019 (UTC)
- 1 - Billy Schaeffer - wikt:record .594: shooting percentage. Ira Leviton (talk) 21:42, 14 December 2019 (UTC)
- 1 - Binghamton Bearcats men's basketball - wikt:a .500: winning percentage. Ira Leviton (talk) 23:05, 14 December 2019 (UTC)
- 4 - Binghamton University basketball scandal - wikt:a .500: winning percentages.
- 1 - Black Knight: The Man Who Guards Me - wikt:n.CH: the name of a movie studio. Ira Leviton (talk) 15:41, 17 December 2019 (UTC)
- 2 - Blacklist (disambiguation) - wikt:b.LaY: the name of an artist. Ira Leviton (talk) 15:41, 17 December 2019 (UTC)
- 2 - Block (permutation group theory) - wikt:B .x: mathematical jargon. Ira Leviton (talk) 18:07, 17 December 2019 (UTC)
- 2 - Blood Lake - re]Search: part of the name "[re]Search my Trash". Ira Leviton (talk) 18:07, 17 December 2019 (UTC)
- 1 - Bo Outlaw - wikt:of .684: shooting percentage. Ira Leviton (talk) 20:31, 17 December 2019 (UTC)
- 1 - Bo Ryan - wikt:an .820: winning percentage. Ira Leviton (talk) 20:31, 17 December 2019 (UTC)
- 2 - Bo Schembechler - wikt:of .796, wikt:of .850: winning percentages.
- 1 - Bo Shepard - wikt:of .812: winning percentage. Ira Leviton (talk) 20:31, 17 December 2019 (UTC)
- 7 - Book of Order - wikt:PC(USA, wikt:PC(USA, wikt:PC(USA, wikt:PC(USA, wikt:PC(USA, wikt:section .0300, wikt:part .0004: all correct; this is the way the Presbyterian Church uses these terms. Ira Leviton (talk) 18:09, 14 December 2019 (UTC)
- 1 - Boriding - wikt:borided: an arcane chemistry term. Ira Leviton (talk) 21:55, 18 December 2019 (UTC)
- 9 - Boron porphyrins - wikt:dipyrromethene)BX, wikt:RBOBR(por, phenyl]borate, wikt:diketonate.The (probably OK: wikt:monoboryl, wikt:diboryl, wikt:diboryl, wikt:diboryl, wikt:diboryl): chemistry jargon. Ira Leviton (talk) 21:55, 18 December 2019 (UTC)
- 3 - Breathalyzer - wikt:COOH(aq: part of a chemistry formula. Ira Leviton (talk) 20:00, 20 December 2019 (UTC)
- 1 - Brian Ford Sullivan - wikt:series .comEDY: the name of a comedy series. Ira Leviton (talk) 21:37, 20 December 2019 (UTC)
- 1 - Broccoli City Festival - wikt:Anderson .Paak: the name of a band. Ira Leviton (talk) 00:24, 22 December 2019 (UTC)
- 1 - Broons - wikt:i.NB: a German style abbreviation, without a space. Ira Leviton (talk)
- 1 - Budha Subba Temple - wikt:you: part of a translation. Ira Leviton (talk) 23:08, 22 December 2019 (UTC)
TS+COMMA+ case notes from 2019-11-20 dump
[edit]- 1 - Bantu mythology - wikt:amazimu, wikt:madimo: not English, but the language isn't specified so I can't add the proper language tag. Ira Leviton (talk) 17:33, 1 January 2020 (UTC) // at a guess, it's almost certainly Bantu. --Xurizuri (talk) 06:16, 23 January 2021 (UTC)
- 1 - Bao Junhui - wikt:dawn,go, wikt:your: in a poem that is quoted. Ira Leviton (talk) 17:33, 1 January 2020 (UTC)
- 2 - Benzo(j)fluoranthene - wikt:chloroethenyl)chrysene, wikt:anti-7β,8α-dihydroxy-9α,10α-epoxy-7,8,9,10-tetrahydrobenzo: chemical names.
- 1 - Beta-Eleostearic acid - wikt:octadeca-9,11,13-trienoic: chemical name. Ira Leviton (talk) 02:37, 30 December 2019 (UTC)
- 1 - Beta-amyrin 24-hydroxylase - wikt:amyrin,AH2: chemical name. Ira Leviton (talk) 02:37, 30 December 2019 (UTC)
- 3 - Betulinic acid - wikt:betulinate: a chemical name. Ira Leviton (talk) 02:37, 30 December 2019 (UTC)
- 4 - Bis(5'-adenosyl)-triphosphatase - wikt:P1,P3, wikt:P1,P3, wikt:P1,P3: parts of chemistry formulas. Ira Leviton (talk) 03:26, 31 December 2019 (UTC)
- 5 - Bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) - wikt:P1,P4, wikt:P1,P4, wikt:P1,P4: parts of chemistry formulas. Ira Leviton (talk) 03:26, 31 December 2019 (UTC)
- 6 - Bis(5'-nucleosyl)-tetraphosphatase (symmetrical) - wikt:P1,P4, wikt:P1,P4, wikt:P1,P4: parts of chemistry formulas. Ira Leviton (talk) 03:26, 31 December 2019 (UTC)
- 8 - Butia purpurascens - wikt:ii,iii, wikt:ii,iii, wikt:escens - "-escens" is a Latin word ending, not a complete word Ingratis (talk) 18:41, 17 December 2019 (UTC)
Cases with notes (C) from 2020-07-20 dump
[edit]T1+
[edit]C-Cep
[edit]- 13 - CCDC130 - wikt:smagly, wikt:smeygly, wikt:smawgly, wikt:wycho, wikt:smagly, wikt:smeygly, wikt:smawgly, wikt:wycho, wikt:stygly, wikt:zoycho, wikt:spogly, wikt:glutobu, wikt:stygly: names of genes. Ira Leviton (talk) 13:10, 22 August 2020 (UTC)
- 1 - CDK-activating kinase - wikt:cyclinH: the name of a protein. Ira Leviton (talk)
- 3 - Cable & Deadpool - wikt:psimitar, wikt:venomsaur, wikt:psimitar: in-universe words. Ira Leviton (talk) 02:11, 21 August 2020 (UTC)
- 1 - California Institute for Telecommunications and Information Technology - wikt:Cal(IT): part of an abbreviation. Ira Leviton (talk) 01:26, 22 August 2020 (UTC)
- 3 - Calliandra angustifolia - wikt:capabo, wikt:chipero, wikt:semein: local names for a plant, but the language isn't mentioned. Ira Leviton (talk) 01:26, 22 August 2020 (UTC)
- 2 - Callistophytaceae - wikt:adpressions: an archaeology term.Ira Leviton (talk) 01:26, 22 August 2020 (UTC)
- 1 -
Callitrichidae - wikt:ceboids:monkeys in the family Ceboidae (plural). Ira Leviton (talk) - 1 - Caltech Intermediate Form - wikt:ypos: part of a mathematical formula (i.e., for "y position"). Ira Leviton (talk) 01:26, 22 August 2020 (UTC)
- 4 -
Caltha - wikt:scalopped, wikt:scalopped, wikt:pantoporate, wikt:codua - 2 - Cam's Delight (1741 ship) - G[eorge], wikt:eorge: deliberately written as "G[eorge]". Ira Leviton (talk) 16:32, 20 August 2020 (UTC)
- 2 - Camp Ondessonk - wikt:slashies, wikt:slashies: an in-universe term. Ira Leviton (talk) 16:32, 20 August 2020 (UTC)
- 1 -
Cancer Institute of New South Wales - wikt:eviQ:a name. Ira Leviton (talk) 18:44, 20 August 2020 (UTC) - 2 -
Canellaceae - wikt:intectate, wikt:cinnamoil:a botany term and a part of a chemical name. Ira Leviton (talk) - 3 -
Cantellated 5-cubes - wikt:sirn, wikt:sibrant, wikt:gibrant:acronyms, in lower case. Ira Leviton (talk) 18:44, 20 August 2020 (UTC) - 2 -
Cantellated 6-orthoplexes - wikt:srog, wikt:siborg:acronyms, in lower case. Ira Leviton (talk) 18:44, 20 August 2020 (UTC) - 4 -
Cantellated 8-simplexes - wikt:srene, wikt:sabrene, wikt:satrene, wikt:gatrene:acronyms, in lower case. Ira Leviton (talk) 18:44, 20 August 2020 (UTC) - 3 -
Canut revolts - wikt:silkers:seems OK. Ira Leviton (talk) 18:44, 20 August 2020 (UTC) - 1 -
Carbonyl olefin metathesis - wikt:alkenation:a type of chemical reaction. Ira Leviton (talk) 03:47, 22 August 2020 (UTC) - 5 -
Carborane acid - wikt:carboranate, wikt:pKas, wikt:carboranate, wikt:carboranate, wikt:carboranate:chemistry terms. Ira Leviton (talk) 03:47, 22 August 2020 (UTC) - 3 - Cardiff English - wikt:dap(per), wikt:fricatised, wikt:pluddle: all showing variations of English spoken in Cardiff. Ira Leviton (talk) 03:47, 22 August 2020 (UTC)
- 1 -
Carltona doctrine - wikt:juridification:a legal term. Ira Leviton (talk) 14:03, 4 August 2020 (UTC) - 1 -
Carnot's theorem (thermodynamics) - wikt:wcy:a mathematical notation. Ira Leviton (talk) 14:03, 4 August 2020 (UTC) - 6 -
Carolus Gallus - wikt:geloovens, wikt:geloovens, wikt:effte, wikt:apocatypseos, wikt:usuque, wikt:authoritatib - 1 -
Carotol - wikt:carotane:a chemical name. Ira Leviton (talk) 13:10, 22 August 2020 (UTC) - 2 -
Carpal bones - wikt:intermediale:the name of a bone in certain types of extinct tetrapods. Ira Leviton (talk) 13:10, 22 August 2020 (UTC) - 1 -
Carroll (given name) - wikt:neoichnologist:a legit word. Ira Leviton (talk) 13:10, 22 August 2020 (UTC) - 1 -
Carrot - wikt:gazarin:a chemical name. Ira Leviton (talk) 13:10, 22 August 2020 (UTC) - 5 - Castro culture - wikt:SUPERTAM(ARICA), wikt:TALABRIC(A), LADRONU[S], BRA[CA], CASTELL[O]: I reduced the ALLCAPS, but the parentheses and brackets are needed to show missing letters or ambiguity. Ira Leviton (talk) 17:21, 22 August 2020 (UTC)
- 1 -
Catajapyx aquilonaris - wikt:entroph:a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC) - 1 -
Catajapyx confusus - wikt:entroph:a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC) - 1 -
Catajapyx ewingi - wikt:entroph:a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC) - 1 -
Catajapyx singularis - wikt:entroph:a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC) - 4 - Catalan Civil War - wikt:pactists, wikt:foralists, wikt:pactists, wikt:foralists: political groups ion the Catalan Civil War. Ira Leviton (talk) 17:21, 22 August 2020 (UTC)
- 1 -
Catalyst 6500 - wikt:dcef:jargon about the Catalyst 6500. Ira Leviton (talk) 17:21, 22 August 2020 (UTC) - 19 - Category (mathematics) - wikt:ob(C), wikt:hom(C), wikt:ob(C), wikt:hom(a, wikt:homC(a, wikt:hom(a, wikt:Mor(a, wikt:C(a, wikt:hom(a, wikt:hom(b, wikt:hom(a, wikt:ob(C), wikt:hom(C), wikt:hom(a, wikt:end(a), wikt:aut(a), wikt:hom(a, wikt:homC, wikt:homset: parts of mathematical formulas. Ira Leviton (talk) 17:21, 22 August 2020 (UTC)
- 3 -
Catherine de Zegher - wikt:hemi(cycle):part of the name of an artwork. Ira Leviton (talk) 17:21, 22 August 2020 (UTC) - 1 -
Cathodic protection - wikt:disbondment:a chemistry term. Ira Leviton (talk) 17:21, 22 August 2020 (UTC) - 2 -
Catholic Church sexual abuse cases in Europe - wikt:juvenate:unclear. Ira Leviton (talk) 17:21, 22 August 2020 (UTC) - 1 - Catocala nymphagoga - wikt:anthracita: part of a species name? Ira Leviton (talk) 17:21, 22 August 2020 (UTC) // I've added the too technical template, the section is unreadable. --Xurizuri (talk) 11:32, 22 January 2021 (UTC)
- 7 - Catuslugi - wikt:Catusl(o), wikt:Catuslou(gus), wikt:Catus(lougo), wikt:Catuslou(gus), wikt:lougo, wikt:slougo, wikt:slowgos: showing word derivations. Ira Leviton (talk) 17:21, 22 August 2020 (UTC)
- Causative alternation - wikt:booki - (3a) The booki fell ti (unaccusative)
wikt:initP - initiation phrase (initP)
wikt:procP - process phrase (procP)
wikt:otoshita - Japanese
Cañadón Asfalto Basin - wikt:padillae, wikt:williensis- fossils of various groups of flora and faunaCdrtools - wikt:dvdrecord, wikt:readcd, wikt:isodebug, wikt:isodump, wikt:scpio, wikt:strar- software-relatedCecropia - wikt:sub)obovoid- (sub)obovoid // biology stuff. plants. --Xurizuri (talk) 11:32, 22 January 2021 (UTC)Cell cycle checkpoint - wikt:cyclinB- primary cyclin utilized is cyclin B.Celtic sacred trees - wikt:millpreve - Celtic mythology- Manx word
wikt:calltuinn - Manx name
wikt:euarCeltic toponymy - wikt:kwenno - Proto-Celtic *kwenno-
wikt:noviios - Old Celtic noviios 'new'
wikt:nowijo - nowijo- 'new'
wikt:boudo - Containing the elements *boudo- 'victory'
wikt:mogunt - From Celtic *mogunt-, 'mighty, great, powerful'
wikt:temeslos - Possibly from Celtic *tames- 'dark' (cf. Celtic *temeslos
wikt:kamulos - From *kamulos 'Camulus'Cement - wikt:cimentum- hydraulic binder, were later referred to as cementum, cimentum- 1 -
Central Atlas Tamazight grammar - wikt:encliticizes:seems legit. Ira Leviton (talk) 20:40, 4 August 2020 (UTC) - 3 -
Central Presbyterian Church (New York City) - <li>, <li>, <li>:I still can't figure out how to fix these. Ira Leviton (talk) 20:40, 4 August 2020 (UTC) - 1 -
Cephalopod egg fossil - wikt:eudemic:a legit word. Not endemic. Ira Leviton (talk) 20:40, 4 August 2020 (UTC)
Cer-Chal
[edit]Ceremonial pipe - wikt:calumel:word used by Norman-French colonisers --Xurizuri (talk) 12:17, 22 January 2021 (UTC)Cernunnos - C]ernunnos, wikt:hurnaz:asked for clarification on the talk page as to why [C]ernunnos has the brackets (it's super not clear from the text). *hurnaz is Germanic. --Xurizuri (talk) 12:17, 22 January 2021 (UTC) → reason: it was a quote of an inscription that had first letter damaged. So put in quote marks.Cerverí de Girona - wikt:lengatges, wikt:leugiers, wikt:marritz, wikt:puese:some possible mix of Catalan, spanish, italian --Xurizuri (talk) 12:17, 22 January 2021 (UTC)Cetopsidae - wikt:cetopsine:Cetopsinae is a subfamily of cetopsidae. a cetopsine belongs to cetopsinae --Xurizuri (talk) 12:17, 22 January 2021 (UTC)Chak 87 EB - wikt:mohals:a caste in this pakistan village.--Xurizuri (talk) 12:17, 22 January 2021 (UTC)Chakhar Mongolian - wikt:xlar, wikt:xnar, wikt:lgui:Chakhar is a dialect of Mongolian. These are word fragments.--Xurizuri (talk) 12:17, 22 January 2021 (UTC)Chalan (music) - wikt:tivra:foreign language. It'll be a Hindustani one if that helps. --Xurizuri (talk) 12:17, 22 January 2021 (UTC)Chalcoscirtus - wikt:chalc:Ancient Greek word fragment
Cham-Chap
[edit]Reviewed & ok
- Chamorro people - wikt:avuncuclan, wikt:achoti, wikt:gupot, wikt:nobenas, wikt:bilimbines
- Champlain, Quebec - wikt:seignieurs
- Chandogya Upanishad - wikt:ushman, wikt:chamasa
- Chandragomin - wikt:gdugs, wikt:gshan, wikt:bzlog, wikt:gzungs
- Chaotic Trading Card Game - wikt:mugician
- Chapari - wikt:deuls
- Chapati (disambiguation) - wikt:safati
Char-Corn
[edit]- These two are D&D. See notes in Wikipedia:Typo Team/moss/S
- 1 - Character class (Dungeons & Dragons) - wikt:shamani: an in-universe word. Ira Leviton (talk) 22:22, 23 August 2020 (UTC)
- 1 - Charon's Claw (novel) - wikt:drows: an in-universe term in this story. Ira Leviton (talk) 16:15, 4 August 2020 (UTC)
- 11 - Characters of StarCraft - wikt:deinfest, wikt:deinfestation, wikt:deinfestation, wikt:terrazine, wikt:terrazine, wikt:terrazine, wikt:deinfestation, wikt:infestors, wikt:deinfested, wikt:deinfested, wikt:quillgor: in universe terms. Ira Leviton (talk) 22:22, 23 August 2020 (UTC)
- 4 - Chelidonine - benzo[c], wikt:chelamine: parts of chemical names. Ira Leviton (talk) 16:15, 4 August 2020 (UTC)
- 2 - Chemical vapor deposition - wikt:Si(OC, wikt:Cu(hfac): parts of chemical formulas. Ira Leviton (talk) 16:15, 4 August 2020 (UTC)
- 1 - Cherax quinquecarinatus - wikt:marroning: a local word when fishing for marron, a local fish. Ira Leviton (talk) 16:15, 4 August 2020 (UTC)
- 1 - Chex Quest - wikt:zorchers: an in-universe term. Ira Leviton (talk) 00:48, 24 August 2020 (UTC)
- 8 - Chimbu–Wahgi languages - wikt:am(a, wikt:n(o, wikt:mo(k, wikt:g)Vm, wikt:embe(m), makV[C], wikt:t(e, wikt:makV: there is no ISO 639 code for these languages.Ira Leviton (talk) 14:03, 4 August 2020 (UTC)
- 1 - China Airlines Flight 676 - wikt:whooler: pitch trim apparatus on an airplane. Ira Leviton (talk) 00:48, 24 August 2020 (UTC)
- 4 - Chorded keyboard - wikt:chordic, wikt:chordic, wikt:chordic, wikt:chordic: adjectival form of chord. Ira Leviton (talk) 00:48, 24 August 2020 (UTC)
- 2 - Christ II - wikt:cen(c), wikt:yr(y): rune markings. Ira Leviton (talk) 14:03, 4 August 2020 (UTC)
- 1 - Chrysothallite - wikt:sanguite - add to wikt Ingratis (talk) 02:22, 16 August 2020 (UTC)
- 1 - Cider apple - wikt:solaxe: a method for planting apples trees. Ira Leviton (talk) 00:44, 19 August 2020 (UTC)
- 2 - Ciechocinek Formation - wikt:prophyritic, wikt:crossbed: archaeologic or geologic terms. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 2 - Cippus Perusinus - Afun[a], wikt:laei: quoting from an ancient stone inscription. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 1 - Circle of Magic - wikt:shakken: an in-universe term. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 1 - Citizenship Aesthetics - wikt:aesthetians: I'm not sure if this is a real word. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 5 - Citole - wikt:citula, wikt:cistole, wikt:cuitole, wikt:cytolys: names of the subject of the page in other languages, but the languages are not named. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 5 - Citrinin - C]Citrinin: part of a chemical term. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 2 - City university test - wikt:protan, wikt:deutran: medical terms. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 10 - Civil law notary - wikt:probativity, wikt:improbated, wikt:probativity, wikt:interlineated, wikt:probativity, wikt:probativity, wikt:notariate, wikt:notariate, wikt:notariate, wikt:notariate: arcane words. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 3 - Cizre - <li>, <li>, <li>: I don't know how else to make tables side by side. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 1 - Clara Parker (sternwheeler) - wikt:draying: an old-fashioned but legit word. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 1 - Clarinet-cello-piano trio - wikt:musicaus: in the title of a music work. Ira Leviton (talk) 18:22, 24 August 2020 (UTC)
- 1 - Classical compound - wikt:astrologism: a fringe word, not sure if it's accepted English. Ira Leviton (talk) 01:56, 24 August 2020 (UTC)
- 4 - Classical elements in popular culture - wikt:ambigrammatic, wikt:ambigrammatic, wikt:elementors, wikt:terrakinesis: in universe terms. Ira Leviton (talk) 01:56, 24 August 2020 (UTC)
- 1 - Clifton Star Chamber Case - wikt:impressees: a bit old-fashioned, but legit. Ira Leviton (talk) 16:15, 8 August 2020 (UTC)
- 2 - Climont - wikt:grangiam, wikt:grangiam: this article is in the process of translation, best to leave it alone for now. Ira Leviton (talk) 16:15, 8 August 2020 (UTC)
- 7 - Clinical metagenomic sequencing - wikt:destructases: a type of enzyme (plural). Ira Leviton (talk) 16:15, 8 August 2020 (UTC)
- 2 - Clinoptilolite - wikt:Al,Si: part of a chemical formula. Ira Leviton (talk) 16:15, 8 August 2020 (UTC)
- 34 - Closure (mathematics) - wikt:x1,xn, wikt:x1,x2, wikt:xi,xi, wikt:clref(R), wikt:clsym(R), wikt:cltrn(R), wikt:f(x, wikt:f(x, wikt:clxxx(R), wikt:clsym(R), wikt:clxxx(R), wikt:cltrn(clsym, wikt:clref(R), wikt:cltrn(clemb, wikt:clsym(clref, wikt:f(b), wikt:f(a), wikt:cltrn(clemb, wikt:clsym(clref, wikt:cltrn(clsym, wikt:clref(R), wikt:difunctionality, wikt:difunctionality, wikt:clsym, wikt:clemb, wikt:clsym, wikt:clemb, wikt:clsym, wikt:clemb, wikt:clsym, wikt:clemb, wikt:clsym, wikt:clemb, wikt:clsym: all mathematical notations or parts of mathematical formulas. Ira Leviton (talk) 01:56, 24 August 2020 (UTC)
- 18 - Cnoidal wave - wikt:K(m), wikt:K(m), wikt:E(m), wikt:K(m), wikt:E(m), wikt:K(m), wikt:E(m), wikt:K(m), wikt:E(m), wikt:sech(z), wikt:cosh(z), wikt:K(m), wikt:E(m), wikt:K(m), wikt:K(m), wikt:K(m), wikt:E(m), wikt:K(m): all mathematical notations or parts of mathematical formulas. Ira Leviton (talk) 01:56, 24 August 2020 (UTC)
- 1 - Cockatoo - wikt:aviculturally: seems OK. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 4 - Codex Alera - wikt:legionares, wikt:legionares, wikt:legionnare, wikt:watercrafters: in universe terms for this story. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 1 -
Codex Basilensis A. N. IV. 4 - wikt:syrp:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 4 -
Codex Ephraemi Rescriptus - wikt:syrh, wikt:syrp, wikt:copbo, wikt:syrp:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 2 -
Codex Koridethi - wikt:copbo, wikt:syrh:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 4 -
Codex Laudianus - wikt:syrp, wikt:copbo, wikt:syrp:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 1 -
Codex Nitriensis - wikt:copbo:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 1 -
Codex Porphyrianus - wikt:syrp:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 1 -
Codex Regius (New Testament) - wikt:copbo:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 2 -
Codex Vaticanus 2061 - wikt:syrh, wikt:copbo:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 3 -
Codex Vercellensis - wikt:syrp, wikt:copbo, wikt:copbo:a type of citation used for codexes. Ira Leviton (talk) 18:28, 25 August 2020 (UTC) - 2 - Coeloglossum - wikt:militarine: name of a chemical. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 1 - Coke (fuel) - wikt:uncoked: seems legit. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 3 - Coleraine (barony) - Catha[i], Catha[i]: showing an ambiguous spelling. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 1 - Collateralized mortgage obligation - wikt:notionalized: arcane, but OK. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 2 - Colombier, Saint Barthélemy - wikt:ameives, wikt:ardrops: local names for animals on Saint Barthélemy. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 3 - Columbia University Marching Band - wikt:miscies, wikt:miscie, wikt:miscie: local slang for miscellaneous, not standard English. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 17 - Columbus's letter on the first voyage - wikt:indi(a), wikt:inve(n), wikt:indi(a), wikt:inve(n), wikt:indi(a), wikt:inve(n), wikt:inve, wikt:inve, wikt:inve: various ambiguously spelled words. Ira Leviton (talk) 18:28, 25 August 2020 (UTC)
- 3 - Combustor - wikt:swirlers, wikt:swirlers, wikt:swirlers: a legit word. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 3 - Common Berthing Mechanism - wikt:deoutfitting, wikt:deberth, wikt:deberth: astronaut/NASA jargon. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 1 - Common chaffinch - wikt:chaffinche: a spelling given in one of the citations
- 3 - Comparison of Afrikaans and Dutch - wikt:glassie(n), wikt:koppie(n), wikt:probleempie(n): showing singular and plural. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 1 - Comparison of OpenGL and Direct3D - wikt:apitest: software jargon. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 3 - Comparison of Pascal and Delphi - wikt:eoln, wikt:eoln, wikt:eoln: software coding jargon. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 21 - Complex polytope - wikt:g)p, q]p, q]p, p[q], wikt:r)q, wikt:pr(q, p[q], p[q], p[q], p[q], p[q], p[z, q[z, r[z, wikt:G(p, wikt:order(p, wikt:order(q, wikt:order(p, q[n, p[q], p[q]: parts of mathematical notations. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 4 - Complexity class - AM[k], AM[k], AM[k], IP[k]: mathematical notations. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 3 - Compounds of fluorine - wikt:cobalt(V), wikt:dihalogen, wikt:fluorocation: chemistry terms. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 1 - Compsodrillia tricatenaria - wikt:appression: a legit word. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 1 - Condor Legion Tank Badge - wikt:reauthorised: British spelling. Ira Leviton (talk) 00:45, 25 August 2020 (UTC)
- 1 - Coniine - wikt:cyanoamide: a chemical name. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 2 - Consonant gradation - wikt:unalternating, wikt:unalternating: legit words. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 1 - Constitutive equation - wikt:u(y): mathematical notation. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 2 - Constructive cooperative coevolution - wikt:SubOpt(pphase, wikt:SubOpt(pphase: software code. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 1 - Contax - wikt:lammels
- 2 - Continuant (mathematics) - wikt:K(n), wikt:brcr: mathematical notations. Ira Leviton (talk) 19:36, 24 August 2020 (UTC)
- 1 - Continuous and progressive aspects - con]versely, wikt:versely: brackets used to clarify a quotation. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 6 - Contour line - wikt:f(x, wikt:anallobars, wikt:isoplats: part of a mathematical formula followed by two meteorological terms. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 22 - Contraction (operator theory) - wikt:Ran(DT), wikt:Ran(DT, wikt:Ran(DT), wikt:U(g), wikt:T(t), wikt:U(t), wikt:U(t), wikt:T(t), wikt:U(t), wikt:T(t), wikt:f(T), wikt:f(T), wikt:fr(T), wikt:f(T), wikt:f(T), wikt:fn(T), wikt:f(T), wikt:T(t), wikt:f(T), wikt:B(z), wikt:P(z), wikt:B(z): parts of mathematical formulas. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 6 - Conus ventricosus - wikt:epaticus, wikt:errosus, wikt:amigus, wikt:emisus, wikt:thuscus, wikt:elpus: synonyms for Conus ventricosus, but some are not accepted. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 4 - Conway polynomial (finite fields) - wikt:fm(x), wikt:fn(xr), Fp[x], wikt:adxd: mathematical formulas. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 4 - Cooperative breeding - wikt:monotocy, wikt:monotocy, wikt:monotocy: an arcane term used in breeding. Ira Leviton (talk) 20:57, 25 August 2020 (UTC)
- 1 - Copolymer - wikt:B)n: mathematical formula. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 1 - Copper - wikt:copper(IV): chemistry notation. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 2 - Copper in architecture - wikt:gasketing, wikt:gasketing: seems to be a legit word. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 1 - Copper(II) carbonate - wikt:pKso: mathematical formula. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 4 - Copper, Bronze and Iron Age sites in Kosovo - wikt:tholoid: a type of rock formation. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 7 - Coptic versions of the Bible - wikt:copbo, wikt:copbo, wikt:copbo, wikt:copbo, wikt:copakh, wikt:copbo, wikt:syrh: abbreviations for Codexes. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 1- Corbitis Atlas - wikt:y(sole): unclear. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 3 - Cornwall - wikt:kibbal, wikt:lutarist: unclear. Ira Leviton (talk) 22:04, 26 August 2020 (UTC)
- 6 - Coroutine - d[produce], d[current], wikt:libpcl, wikt:libaco, wikt:fibjs, wikt:fibjs: all software jargon. Ira Leviton (talk) 22:11, 23 August 2020 (UTC)
- 1 - Corpus Aristotelicum - wikt:hylomorphs: legit word. Ira Leviton (talk) 22:11, 23 August 2020 (UTC)
- 10 - Correspondence of Lorraine toponyms in French and German - wikt:afisna, wikt:avisna, wikt:prussification, wikt:prussification, wikt:prussify, wikt:unemphasized: linguistic terms. Ira Leviton (talk) 22:11, 23 August 2020 (UTC)
- 3 - Corum Jhaelen Irsei - wikt:mabden, wikt:mabden: an in-universe word. Ira Leviton (talk) 22:11, 23 August 2020 (UTC)
- 3 - Cosmic microwave background - wikt:P(t), wikt:P(t), wikt:P(t): parts of mathematical formulas. Ira Leviton (talk) 22:11, 23 August 2020 (UTC)
- 1 - Courtaulds Red Scar Works Preston - wikt:coneing: British spelling. Ira Leviton (talk) 19:18, 23 August 2020 (UTC)
- 8 - Coxeter notation - wikt:gcd(p, wikt:gcd(p, wikt:gcd(p, Y[X], p[q], p[q], p[q], p[r]: mathematical notations. Ira Leviton (talk) 19:18, 23 August 2020 (UTC)
- 1 - Crash Canyon - wikt:buggied: part of the slang term "punch-buggied" (past tense). Ira Leviton (talk) 19:34, 20 August 2020 (UTC)
- 1 - Crassulaceae - wikt:superrosid: a type of plant. Ira Leviton (talk) 19:34, 20 August 2020 (UTC)
- 1 - Creativity - wikt:preinventive: seems legit. Ira Leviton (talk) 19:18, 23 August 2020 (UTC)
- 5 - Creode - wikt:creodes, wikt:creodes, wikt:creodes, wikt:creodes, wikt:chreods: plurals and made-up words for the subject of the page, which is also a made-up word. Ira Leviton (talk) 19:18, 23 August 2020 (UTC)
- 8 - Creosote - wikt:phosphotal, wikt:eosot, wikt:geosot, wikt:phosot, wikt:creosotal, wikt:vaporizor, wikt:kreosotum, wikt:pKas: chemical names, the last is a chemical/mathematical term. Ira Leviton (talk) 19:18, 23 August 2020 (UTC)
- 1 - Crocosphaera watsonii - wikt:nifX: the name of a gene. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 3 - Crohn's disease - wikt:n(Glc, wikt:mannins, wikt:nonstricturing: part of a chemical name, a type of molecule, and a word in the title of an article in a medical journal. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 6 - Cron - wikt:dcron, wikt:dcron, wikt:mcron, wikt:mcron, wikt:mcron, wikt:mcron: variants of the subject of this page. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 1 - Cross River National Park - wikt:gamalin: the generic name of a pesticide. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 1 - Cross of Mathilde - wikt:ABBATI(SSA): part of an inscription on an ancient stone, with parentheses used for the unreadable part. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 1 - Cruising with Ruben & the Jets - wikt:weazlings: a type of singing? Might not be a real word. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 2 - Crusader states - wikt:cofraternity, wikt:balliage: a legit word, and an unclear word. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 1 - Cryptographically secure pseudorandom number generator - wikt:outlen: added a 'clarify' template. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 3 - Crêpe (textile) - wikt:janigor, wikt:mosseux, wikt:ondese: old trademarked names. Ira Leviton (talk) 14:59, 23 August 2020 (UTC)
- 1 - Ctenjapyx boneti - wikt:entroph: a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC)
- 1 - Ctenjapyx parkeri - wikt:entroph: a type of insect. Ira Leviton (talk) 01:16, 21 August 2020 (UTC)
- 1 - Cugel's Saga - wikt:draying: an old-fashioned but legit word. Ira Leviton (talk) 01:16, 21 August 2020 (UTC)
- 1 - Culchie - wikt:dulchies: a made up word used for some Irish football fans. Ira Leviton (talk) 02:24, 23 August 2020 (UTC)
- 2 - Cult Awareness Network - wikt:deprogrammee, wikt:deprogrammees: someone undergoing deprogramming from a cult (plural): Ira Leviton (talk) 02:24, 23 August 2020 (UTC)
- 1 - Culture in Dresden - wikt:Himmelb(l): written deliberately. Ira Leviton (talk) 02:24, 23 August 2020 (UTC)
- 1 - Culture of Papua New Guinea - wikt:singsings: a local word. Ira Leviton (talk) 02:24, 23 August 2020 (UTC)
- 3 - Culture of Veliko Tarnovo - wikt:divtation, wikt:zohus: unclear. Ira Leviton (talk) 02:24, 23 August 2020 (UTC)
- 34 - Cumbrian dialect - wikt:h)arreet, wikt:warm(it, wikt:eltr, wikt:glisky, wikt:gliskr, wikt:yakeren, wikt:arreet, wikt:bevvie, wikt:kystie, wikt:ladgeful, wikt:byuts, wikt:byuts, wikt:keppards, wikt:yhuk, wikt:shillies, wikt:skemmy, wikt:twuk, wikt:liggin, wikt:gadgey, wikt:liggin, wikt:glisky, wikt:mizzlin, wikt:syling, wikt:whaarm, wikt:whaarm, wikt:whure, wikt:ahreet, wikt:mattttte, wikt:thasel, wikt:strangba, wikt:cluwt, wikt:tuwn, wikt:yandick, wikt:taendick: all Cumbrian dialect, which doesn't have an Iso 693 code.
- 5 - Curacin A - wikt:ACP1,ACP2, wikt:Finally,an, wikt:S)HMG, wikt:catlyzes, wikt:dehydratates
- 1 - Curio, Ticino - wikt:eradicaed: in a quotation; the citation is not online. Ira Leviton (talk) 19:33, 22 August 2020 (UTC)
- 2 - Curious George Learns the Alphabet - wikt:dalg, wikt:glidj: made up words in this book. Ira Leviton (talk) 19:33, 22 August 2020 (UTC)
- 9 - Curium - wikt:curium(IV), wikt:americium(V), wikt:curium(IV), wikt:M(II), wikt:curium(IV), wikt:yl)pyridine, wikt:curyl: chemistry notations and formulas. Ira Leviton (talk) 19:33, 22 August 2020 (UTC)
- 2 - Cushing House - wikt:euthenic, wikt:demonymously: rare but legitimate words. Ira Leviton (talk) 19:33, 22 August 2020 (UTC)
- 1 - Cyanogen fluoride - wikt:nitrilating: a chemistry term.
- 3 - Cyathus striatus - wikt:cyathins, wikt:striatins, wikt:cyathadonic: a group of different organisms in this genus, a group of related chemicals, and a chemistry term. Ira Leviton (talk) 19:01, 22 August 2020 (UTC)
- 1 - Cyberfeminism - wikt:cyborgian: a legit word. Ira Leviton (talk) 19:01, 22 August 2020 (UTC)
- 9 - Cypenamine - (probably OK: wikt:trans-2-phenylcyclopentan-1-amine, wikt:cis-2-phenylcyclopentan-1-amine, wikt:trans-2-phenylcyclopentan-1-amine, wikt:trans-2-phenylcyclopentan-1-amine, wikt:trans-2-phenylcyclopentan-1-amine, wikt:trans-2-phenylcyclopentan-1-amine, wikt:cis-2-phenylcyclopentan-1-amine, wikt:cis-2-phenylcyclopentan-1-amine, wikt:cis-2-phenylcyclopentan-1-amine): chemical names. Ira Leviton (talk) 19:01, 22 August 2020 (UTC)
- 1 - Cyrilovite - wikt:typhylite: a type of mineral or rock. Ira Leviton (talk) 19:01, 22 August 2020 (UTC)
- 2 - Cytochrome c family - wikt:cytC, wikt:cytC: genetics or molecular biology abbreviation. Ira Leviton (talk) 19:01, 22 August 2020 (UTC)
TS+DOT
[edit]- 1 - CDisplay - wikt:or .cba: OK, explaining a software file extension. Ira Leviton (talk) 01:57, 10 August 2020 (UTC)
- 1 - Calliandra surinamensis - wikt:myrectin: a chemical name. Ira Leviton (talk) 18:44, 9 August 2020 (UTC)
- 1 - Camporee - wikt:camporall: a scouting term. Ira Leviton (talk) 15:53, 9 August 2020 (UTC)
- 3 - Canon Court de 105 M(montagne) modèle 1919 Schneider - wikt:le.GebH, wikt:le.GebH, wikt:le.GebH: German style abbreviations, with no space after the period. Ira Leviton (talk) 23:19, 8 August 2020 (UTC)
- 1 - Cao Fei - wikt:i.Mirror: the name of an artwork. Ira Leviton (talk) 23:19, 8 August 2020 (UTC)
- 1 - Carenzia trispinosa - wikt:extracarinal: an arcane but legit word. Ira Leviton (talk) 21:32, 8 August 2020 (UTC)
- 1 - Carrickfergus Learning Community - wikt:e.Business: legit use. Ira Leviton (talk) 16:15, 8 August 2020 (UTC)
- 2 - Catharanthus roseus - wikt:leurosine: a chemical name. Ira Leviton (talk) 20:46, 7 August 2020 (UTC)
- 1 - Cavall - wikt:ms.K: an abbreviation. Ira Leviton (talk) 20:46, 7 August 2020 (UTC)
- 1 - Cell membrane - wikt:leptoscope: a device for measuring the thickness of membranes.
- 1 - Cephalometric analysis - wikt:arcial: a legit term. Ira Leviton (talk) 17:30, 7 August 2020 (UTC)
- 1 - Chemokine - wikt:intercrines: a legit term in molecular biology. Ira Leviton (talk) 17:41, 5 August 2020 (UTC)
- 1 - Chengam - wikt:vatunal: unclear. Ira Leviton (talk) 17:41, 5 August 2020 (UTC)
- 2 - Chenopodiastrum - wikt:spicately: a biology term. Ira Leviton (talk) 17:41, 5 August 2020 (UTC)
- 1 - Chic McSherry - wikt:iTravel-Cabo.com: a website. Ira Leviton (talk) 01:19, 5 August 2020 (UTC)
- 4 - Chimur - wikt:prossion, wikt:prossion, wikt:prossion, wikt:prossion. Unclear. Ira Leviton (talk) 20:40, 4 August 2020 (UTC)
- 3 - China Railway High-speed - wikt:A(L), wikt:B(L), wikt:C(L): Chinese railroad car designations. Ira Leviton (talk) 18:42, 4 August 2020 (UTC)
- 1 - Clarion (programming language) - wikt:clarion.Net: software jargon. Ira Leviton (talk) 19:08, 2 August 2020 (UTC)
- 3 - Claw Boys Claw - uga[r], uga[r]: part of "$uga[r]" in a song title. Ira Leviton (talk) 19:08, 2 August 2020 (UTC)
- 19 - Coherence (signal processing) - wikt:x(t), wikt:y(t), wikt:Gxy(f), wikt:Gxx(f), wikt:Gyy(f), wikt:y(t), wikt:x(t), wikt:x(t), wikt:y(t), wikt:h(t), wikt:Y(f), wikt:y(t), wikt:H(f), wikt:x(t), wikt:y(t), wikt:y(t), wikt:x(t), wikt:x(t), wikt:y(t): parts of mathematical formulas. Ira Leviton (talk) 00:23, 2 August 2020 (UTC)
- 3 - Commune - wikt:communalization: seems legit, meaning the process of communalizing, or forming communes. Ira Leviton (talk) 20:55, 1 August 2020 (UTC)
- 2 - Complete dentures - wikt:decoronation, wikt:incisally: dentistry terms. Ira Leviton (talk) 18:44, 1 August 2020 (UTC)
- 1 - Complexity Gaming - wikt:compLexity.Black: the name of a company. Ira Leviton (talk) 18:44, 1 August 2020 (UTC)
- 1 - Conjugated estrogens - wikt:resulfated: a chemistry term. Ira Leviton (talk) 15:31, 1 August 2020 (UTC)
- 6 - Constructing skill trees - wikt:G(t, wikt:prior(p, wikt:particle(model, wikt:particle(current, wikt:vector(p, wikt:p.MAP: parts of mathematical formulas and software code. Ira Leviton (talk) 14:38, 1 August 2020 (UTC)
- 4 - Contorted aromatics - wikt:P(o, hi]aceanthrylene, wikt:rubicene, wikt:rubicene: parts of chemical names. Ira Leviton (talk) 04:17, 1 August 2020 (UTC)
- 11 - Control theory - wikt:y(t), wikt:r(t), wikt:P(s), wikt:F(s), wikt:Y(s), wikt:R(s), wikt:Y(s), wikt:R(s), wikt:u(t), wikt:y(t), wikt:r(t): parts of mathematical formulas. Ira Leviton (talk) 04:17, 1 August 2020 (UTC)
- 2 - Coonagh, Limerick City - wikt:gandelows, wikt:gandelows: a type of boat (plural). Ira Leviton (talk) 15:03, 30 July 2020 (UTC)
- 1 - Cooperia oncophora - wikt:gelectins: the name of a group of chemicals. Ira Leviton (talk) 15:03, 30 July 2020 (UTC)
- 1 - Coprinopsis lagopus - wikt:lagopodins: the name of a group of chemicals. Ira Leviton (talk) 15:03, 30 July 2020 (UTC)
- 3 - Cotlar–Stein lemma - wikt:T(x), wikt:T(x): parts of mathematical formulas. Ira Leviton (talk) 16:54, 30 July 2020 (UTC)
- 1 - Cppdepend - wikt:m.CyclomaticComplexity: software coding language. Ira Leviton (talk) 16:54, 30 July 2020 (UTC)
- 4 - Cumulative frequency analysis - wikt:Fg(Lk, wikt:Pc(Uk), wikt:Pc(Lk), wikt:t.Sd: parts of mathematical formulas. Ira Leviton (talk) 15:09, 31 July 2020 (UTC)
- 3 - Custom Robo (1999 video game) - wikt:holoseum, wikt:holoseum: an in-universe term in this video game. Ira Leviton (talk) 17:30, 31 July 2020 (UTC)
- 4 - Cyanography - wikt:cyanographic, wikt:cyanographic, wikt:cyanographic: seems legit. Ira Leviton (talk) 19:06, 31 July 2020 (UTC)
- 2 - Cyber Anakin - wikt:ournation-school.com, wikt:ournation-school.com: a website. Ira Leviton (talk) 19:06, 31 July 2020 (UTC)
- 3 - Cycadales - wikt:ayrius, wikt:pregerminate: a local name for a plant in an unclear aboriginal language, and a botany term. Ira Leviton (talk) 19:06, 31 July 2020 (UTC)
- 6 - Cylindrical coordinate system - wikt:atan(y: part of software code. Ira Leviton (talk) 19:06, 31 July 2020 (UTC)
- 1 - Cypher (Spektr album) - wikt:kl.K: appears to be the name of a musician. Ira Leviton (talk) 19:06, 31 July 2020 (UTC)
TS+COMMA+
[edit]C-Cz (except for two with hundreds of entries, left above)
[edit]- 2 - C space - wikt:x0,x1, wikt:y1,y2: mathematical notations. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 2 - C19orf70 - wikt:APOOL,STOML2, wikt:IMMT,MTX1: names of proteins. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 24 - CARINE - wikt:B1,B2, wikt:R1,B3, wikt:R2,B4, wikt:B1,B2, wikt:R1,B3, wikt:R2,B4, wikt:f(a), wikt:clause(s), wikt:wealthy(Y), wikt:smart(Y), wikt:beautiful(Y), wikt:loves(X, wikt:wealthy(Y), wikt:smart(Y), wikt:beautiful(Y), wikt:loves(X, wikt:wealthy(Jane), wikt:smart(Jane), wikt:beautiful(Jane), wikt:loves(John, wikt:P(x), wikt:Q(a, wikt:P(x), wikt:Q(a: parts of mathematical formulas and examples. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 5 - CCA tRNA nucleotidyltransferase - wikt:CTP,CTP, wikt:cytidylyl,cytidylyl, wikt:CTP(ATP), wikt:ATP(CTP), wikt:adenylyl(cytidylyl): parts of chemical abbreviations or names. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 4 - CEM and SSM chips in synthesizers - wikt:Saw,Tri, wikt:Saw,Tri, wikt:VCF,VCA, wikt:VCF,VCA: undefined jargon. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 2 - CENTAG wartime structure in 1989 - wikt:Division,note, wikt:Forward)note: a superscript, probably could be coded better but I don't know how. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 1 - CFR - wikt:C2,C8: part of a chemical name. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 10 - CIE 1931 color space - wikt:xmix,ymix, wikt:x1,y1, wikt:x2,y2, wikt:xn,yn, wikt:xmix,ymix, wikt:x1,y1, wikt:x2,y2, wikt:xmix,ymix, wikt:x1,y1, wikt:x2,y2: mathematical notations. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 1 - CMP-N-acetylneuraminate monooxygenase - wikt:acetylneuraminate,ferrocytochrome: part of an enzyme name, correct with no space after the comma. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 1 - CORO6 - wikt:e(EUCOMM): molecular biology jargon. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 1 - CYP8B1 - wikt:alpha,12: part of a chemical name. Ira Leviton (talk) 22:25, 18 August 2020 (UTC)
- 3 - Calculus (dental) - wikt:Er,Cr, wikt:Er,CR, wikt:Er,Cr: an abbreviation for a type of laser. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 3 - Calixarene - wikt:C2v,C4v, calix[n], calix[n]: chemistry abbreviations. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 2 - Camera matrix - wikt:X1,X2, wikt:X1,X2: mathematical notation. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 1 - Camphor 1,2-monooxygenase - wikt:camphor,reduced: part of an enzyme name, no space after the comma is correct. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 1 - Camphor 5-monooxygenase - wikt:camphor,reduced: ditto. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 1 - Cannabinoid - wikt:dodeca-2E,4E,8Z,10E/Z-tetraenoic-acid-isobutylamide: a chemical name. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 4 - Cantor function - wikt:xk,yk, wikt:fn(x), wikt:y(x), wikt:Cz(y): mathematical notations. Ira Leviton (talk) 23:12, 12 August 2020 (UTC)
- 1 - Capacitive deionization - wikt:Φv,fresh: part of a chemical notation. Ira Leviton (talk) 01:23, 13 August 2020 (UTC)
- 4 - Capnellene - wikt:cis,anti, wikt:annululation, wikt:hirsutanes: part of a chemical formula and chemistry jargon. Ira Leviton (talk) 01:23, 13 August 2020 (UTC)
- 2 - Carbokentbrooksite - wikt:Na,Ce, wikt:NbSiO(Si: parts of chemical formulas. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 1 - Carbon-monoxide dehydrogenase (ferredoxin) - wikt:monoxide,water: this seems to be, correct without a space after a comma. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 9 - Carbonate mineral - wikt:Ni,Mg, wikt:Cu,Zn, wikt:Zn,Cu, wikt:CaFe(CO, wikt:CaMg(CO, wikt:Ca(CO, wikt:CaZn(CO, wikt:BaCa(CO, wikt:Ca(UO: parts of chemical formulas. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 1 - Cardiac action potential - wikt:Ito,fast: this is part of a medical notation/formula. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 1 - Carleman's inequality - wikt:a1,a2: part of a mathematical formula. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 3 - Carlos Andrés Segovia - wikt:dwellingness, wikt:unworld: arcane terms in philosophy or religion. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 19 - Carnot method - wikt:fF,el, wikt:fF,th, wikt:fF,el, wikt:fF,th, wikt:fPE,el, wikt:fF,el, wikt:fPE,th, wikt:fF,th, wikt:fF,el, wikt:fF,th, wikt:ηx,total, wikt:ηx,total, wikt:ηx,el, wikt:ηx,th, wikt:ηx,total, wikt:ηx,el, wikt:ηx,th, wikt:ln(TFF, wikt:prechain: parts of mathematical formulas and a physics term. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 6 - Cartan's criterion - wikt:ai,aj, wikt:j)ai, wikt:Tr(b, L[t], tnL[t], C[t]: parts of mathematical formulas. Ira Leviton (talk) 19:35, 12 August 2020 (UTC)
- 5 - Cell Transmission Model - wikt:x0,t0, wikt:x0,t0, wikt:K(x, wikt:A(x, wikt:q(x: parts of mathematical formulas. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 8 - Centre (geometry) - wikt:ta,tb, wikt:f(a, wikt:f(b, wikt:f(c, wikt:f(ta, wikt:thf(a, wikt:f(a, wikt:f(a: parts of mathematical formulas. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 5 - Centroid - wikt:x0,y0, wikt:x1,y1, wikt:Sk(z), wikt:Sy(x), wikt:Sx(y): parts of mathematical formulas. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 2 - Cerastocytin - wikt:Ile98,Val99, wikt:thrombocytin, wikt:thrombocytin: the name of an enzyme. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 8 - Cerner CCL - wikt:i_patient1,cid, wikt:echo(build, wikt:echo(build, wikt:class(c, wikt:echo(build, wikt:echorecord(c, wikt:class(c, wikt:echo(build: software coding. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 2 - Ceyuan haijing - wikt:HSYY,KSYV, wikt:HNQ,QSK: mathematical notations. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 22 - Chain rule for Kolmogorov complexity - wikt:a1,b1, wikt:a2,b2, wikt:ae,be, wikt:a1,b1, wikt:a2,b2, wikt:KP(x, wikt:KP(x), wikt:KP(y, wikt:I(x, wikt:I(y, wikt:O(log, wikt:K(x, wikt:log(K, wikt:K(x, wikt:K(x, wikt:K(y, wikt:K(x, wikt:K(a, wikt:K(x, wikt:K(x, wikt:K(x, wikt:K(x: parts of mathematical formulas. Ira Leviton (talk) 23:20, 13 August 2020 (UTC)
- 1 - Chalcone synthase - wikt:C1,C6: chemistry notation Voidify (talk) 07:34, 14 August 2020 (UTC)
- 1 - Champernowne constant - wikt:a0,a1: math notation Voidify (talk) 07:34, 14 August 2020 (UTC)
- 4 - Champions of Change (award) - wikt:LS,Jamshedpur, wikt:Godda,Jharkhand, wikt:Virudhunagar,Tamilnadu, wikt:DM,West
- 7 - Chandy–Misra–Haas algorithm resource model - wikt:Pa,Pb, wikt:probe(i, wikt:dependentk(i), wikt:dependentk(i), wikt:dependentk(i), wikt:probe(i, wikt:O(m: all mathematical jargon or parts of formulas. Ira Leviton (talk) 22:08, 15 August 2020 (UTC)
- 2 - Chebyshev–Markov–Stieltjes inequalities - wikt:P0,P1, wikt:P0,P1: mathematical notation. Ira Leviton (talk) 17:21, 14 August 2020 (UTC)
- 4 - Cheilomenes sexmaculata - wikt:UUDD,UUDd, wikt:UuDD,UuDd, wikt:Uudd,UUdd, wikt:uuDD,uuDd: genetics jargon. Ira Leviton (talk) 17:21, 14 August 2020 (UTC)
- 1 - Chitobiosyldiphosphodolichol beta-mannosyltransferase - wikt:beta-1,4-D-mannosylchitobiosyldiphosphodolichol: a chemical name. Ira Leviton (talk) 18:55, 14 August 2020 (UTC)
- 9 - Chomsky normal form - wikt:ab,aba, wikt:abaa,abab, wikt:abac,abb, wikt:bab,bac, wikt:bb,bc, wikt:START,TERM, wikt:BIN,DEL, wikt:START,BIN, wikt:DEL,UNIT: mathematical and software notations. Ira Leviton (talk) 14:27, 15 August 2020 (UTC)
- 2 - Chore division - wikt:E2,E3, wikt:max(E: mathematical notations. Ira Leviton (talk) 14:27, 15 August 2020 (UTC)
- 1 - Christophe Bruno - wikt:Bruno,2417: part of a url. Ira Leviton (talk) 16:50, 15 August 2020 (UTC)
- 1 - Circular points at infinity - wikt:x0,y0: mathematical notation. Ira Leviton (talk) 22:42, 15 August 2020 (UTC)
- 2 - Circumscribed circle - wikt:vx,vy: mathematical notation. Ira Leviton (talk) 22:42, 15 August 2020 (UTC)
- 1 - Cis-2-enoyl-CoA reductase (NADPH) - wikt:cis-2,3-dehydroacyl-CoA: a chemical name. Ira Leviton (talk) 22:42, 15 August 2020 (UTC)
- 1 - Classic RISC pipeline - wikt:r10,r3: software coding. Ira Leviton (talk) 21:04, 16 August 2020 (UTC)
- 2 - Clonewheel organ - wikt:daOrgan: the brand name of an organ (musical instrument). Ira Leviton (talk) 02:24, 16 August 2020 (UTC)
- 1 - Closed testing procedure - wikt:H1,H2: mathematical notation. Ira Leviton (talk) 02:24, 16 August 2020 (UTC)
- 6 - Cluster algebra - wikt:bx,yby, wikt:bx,yby, wikt:Q(x, k[x, wikt:A(S, wikt:A(S: mathematical notations. Ira Leviton (talk) 02:24, 16 August 2020 (UTC)
- 4 - Cobalt - wikt:II,III, wikt:cobalt(II, wikt:cobalt(I), wikt:cobalt(V): chemical notations. Ira Leviton (talk) 23:12, 16 August 2020 (UTC)
- 2 - Cobalt oxide nanoparticle - wikt:II,III, wikt:cobalt(II: chemical notations. Ira Leviton (talk) 23:12, 16 August 2020 (UTC)
- 6 - Cognate linkage - wikt:OA,A1, wikt:OB,B1, wikt:ΔA2,C2, wikt:ΔD,C3, wikt:OC,C2, wikt:ΔOA,OC: mathematical notations. Ira Leviton (talk) 23:12, 16 August 2020 (UTC)
- 49 - Cohomology - wikt:Xα,Aα, wikt:Xα,Aα, wikt:Xα,Aα, wikt:Xα,Aα, wikt:ker(di), wikt:im(di, wikt:Hi(X, wikt:Hi(X, wikt:ker(d), wikt:im(d), wikt:ker(d), wikt:im(d), wikt:Hi(X, wikt:Hi(X, wikt:Hi(X, wikt:Hi(X, wikt:Hi(X, wikt:Hi(X, Z[x], Z[x], wikt:Hi(X, wikt:Hj(Y, wikt:j(X, wikt:Hi(X, wikt:Hj(X, wikt:Hi(X, wikt:Hj(Y, wikt:Hn(X, wikt:Hr(X, wikt:K(A, wikt:Hj(K, wikt:K(A, wikt:K(Z, wikt:Hi(X, wikt:Hj(X, wikt:i(X, wikt:Hn(X, wikt:Hi(X, wikt:Hi(X, wikt:ToriR(M, wikt:ExtiR(M, wikt:HomR(M, wikt:Hi(X, wikt:Exti(ZX, wikt:Hi(P), wikt:hi(X, wikt:hi(A), wikt:hi(A), wikt:hi(A: mathematical notations. Ira Leviton (talk) 23:12, 16 August 2020 (UTC)
- 13 - Color vision - wikt:Wmin,Wmax, wikt:Wmin,Wmax, wikt:Wmin,Wmax, wikt:C(w), wikt:s(w), wikt:m(w), wikt:l(w), wikt:C(w), wikt:s(w), wikt:C(w), wikt:m(w), wikt:C(w), wikt:l(w): mathematical notations. Ira Leviton (talk) 13:36, 17 August 2020 (UTC)
- 2 - Column-oriented DBMS - wikt:Mary,80000, wikt:Bob,55000: software coding. Ira Leviton (talk) 13:36, 17 August 2020 (UTC)
- 12 - Combinatorial design - wikt:s1,s2, wikt:BTD(V, wikt:BTD(n), wikt:BTD(n), wikt:H(s, wikt:L(n, wikt:L(n, wikt:MD(v, wikt:MD(v, wikt:MTS(v, wikt:PG(n, wikt:PG(n: mathematical notations. Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 5 - Combinatorial number system - wikt:c2,c1, wikt:c2,c1, wikt:B50,MATCH, wikt:INDEX(B, wikt:combinadics: mathematical notations, and an arcane but legitimate word. Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 2 - Common logperch - wikt:saugeyes: a type of fish (plural). Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 26 - Complementation of Büchi automaton - wikt:Q1,Q2, wikt:q1,q2, wikt:q1,q2, wikt:q1,q2, wikt:αp,Q2, wikt:βp,Q1, wikt:Q1,Q2, wikt:f(p), wikt:f(p), wikt:Lf(Lg), wikt:w(i, wikt:w(i, wikt:w(ij, wikt:Lf(Lg), wikt:Lf(Lg), wikt:L(A), wikt:L(A), wikt:L(A), wikt:Lf(Lg), wikt:Lf(Lg), wikt:L(A), wikt:Lf(Lg), wikt:L(A), wikt:L(A), wikt:Lf(Lg), wikt:L(A): mathematical notations. Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 17 - Complex logarithm - wikt:ez,Im, wikt:arctan(y, wikt:Log(z, wikt:L(z), wikt:L(z), wikt:L(ei, wikt:L(e, wikt:L(z), wikt:L(z), wikt:L(z), wikt:f(a), wikt:Log(z), wikt:L(z), wikt:eg(z), wikt:f(z), wikt:f(z), wikt:f(a): mathematical notations. Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 7 - Computability theory - wikt:y1,y2, wikt:f(n), wikt:f(n), wikt:f(n), wikt:U(p), wikt:A(xk), wikt:f(n): mathematical notations. Ira Leviton (talk) 20:24, 17 August 2020 (UTC)
- 2 - Concise Command Language - wikt:PROG3,SUB3A, wikt:PROG3,SUB3A: software coding. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 2 - Concordant pair - wikt:X1,Y1, wikt:X2,Y2]: mathematical notation. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 1 - Conditional short-circuit current - wikt:t0,t1: mathematical notation. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 9 - Condorcet method - wikt:runner,opponent, wikt:opponent,runner, wikt:runner,opponent, wikt:opponent,runner, wikt:runner,opponent, wikt:opponent,runner, wikt:runner,opponent, wikt:opponent,runner, wikt:N(N: mathematical notations. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 1 - Conjugate gradient method - wikt:Df(x): mathematical notation. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 7 - Connection form - wikt:TM,TM, wikt:Hom(TM, wikt:GL(k), wikt:GLn(C), wikt:n(R), wikt:GL(k), wikt:T(FGE): mathematical notations. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 1 - Conradh na Gaeilge - wikt:tSratha: unclear. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 3 - Construction industry of India - wikt:stability,high, wikt:growth,such, wikt:policies,regulations
- 7 - Contai - wikt:sillpo: unclear. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 20 - Control table - wikt:R14,R0, wikt:R0,TRY, wikt:R14,R15, wikt:R14,R14, wikt:R14,CT1X, wikt:R14,R15, wikt:R14,R14, wikt:R14,CT1X, wikt:R15,CT1, wikt:case0,case1, wikt:case2,case3, wikt:default,Add, wikt:Subtract,Multiply, wikt:X(R, wikt:A(DEFAULT), wikt:A(SUBTRACT), wikt:A(DIVIDE), wikt:X(R, wikt:A(ADD), wikt:A(MULTIPLY): mathematical notations. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 67 - Controlled Drugs and Substances Act - wikt:morpholinyl)ethyl, dibenzo[de, g]quinoline, wikt:propenyl)morphinan, wikt:propenyl)morphinan, g]isoquinolin, wikt:diphenylbutyryl)pyrrolidine, wikt:diphenylbutyryl)pyrrolidine, wikt:piperidino)piperidine, wikt:yl)ethyl, piperidyl]propionanilide, wikt:thienyl)ethyl, wikt:thienyl)ethyl, wikt:cyclohexyl)phenol, dibenzo[b, d]pyran, dibenzo[b, d]pyran, dibenzo[b, d]pyran, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)indole, wikt:naphthoyl)pyrrole, wikt:naphthoyl)pyrrole, wikt:iodobenzoyl)indole, wikt:morpholinyl)ethyl, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, wikt:yl)acetate, ethyl]indole, ethyl]indole, wikt:b)indole, wikt:b)indol, wikt:aminobutyl)indole, wikt:phenylcarbamoyl)sydnone, dibenzo[a, d]cyclohepten, wikt:yl)amino, wikt:yl)barbituric, wikt:butenyl)barbituric, wikt:diethylamino)propiophenone, a]isoindol, dibenzo[b, dibenzo[b, c]isoxazole, c]pyrazole, a]pyridine, c]pyran, wikt:l-11-propargyl-1,2,3,9,10,10a-hexahydro-4H-10,4a-iminoethanophenanthren-6-ol: parts of chemical names. Ira Leviton (talk) 02:02, 18 August 2020 (UTC)
- 8 - Cooperative MIMO - wikt:nk,Nk, HKT]T, HKT]T, yKT]T, WKT]T, sKT]T, nKT]T: mathematical notations. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 2 - Coordination game - wikt:Stag,Stag, wikt:Hare,Hare: parts of a mathematical formula. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 9 - Copper indium gallium selenide solar cells - wikt:CI(G), wikt:selenization, wikt:selenization, wikt:selenization, wikt:selenization: an arcane abbreviation and an arcane chemistry term. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 1 - Corallochytrium - wikt:palintomic: an arcane scientific term. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 1 - Corticosterone 18-monooxygenase - wikt:corticosterone,reduced: part of the name of an enzyme, correct without a space after the comma. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 6 - Courant minimax principle - wikt:xj,xk, wikt:q(x), wikt:q(x), wikt:q(x, wikt:q(xk), wikt:q(x): mathematical notations. Ira Leviton (talk) 15:04, 18 August 2020 (UTC)
- 1 - Critical Incident Technique - wikt:wartime,328: this is a formatting issue that I don't know how to correct. Ira Leviton (talk) 16:30, 18 August 2020 (UTC)
- 1 - Cybersecurity standards - wikt:COm,TS: marked with clarification needed template. Ira Leviton (talk) 20:00, 18 August 2020 (UTC)
- 6 - Cyclic code - wikt:cn,c1, wikt:c1,c2, wikt:λcn,c1, wikt:Ham(r, wikt:Ham(r, wikt:Ham(r: mathematical notations. Ira Leviton (talk) 20:00, 18 August 2020 (UTC)
- 6 - Cyclophane - wikt:in,in, n]metacyclophanes, n]paracyclophanes, n]paracyclophane, wikt:poly(p, n]CPPs: all are chemistry notations or parts of chemical formulas, even the first one. Ira Leviton (talk) 20:00, 18 August 2020 (UTC)
- 1 - Cyrtophora exanthematica - wikt:II,III: edit reverted, with a message that it's correct, with no space after the comma. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Cyrtophora parangexanthematica - wikt:II,IV: edit reverted, with a message that it's correct, with no space after the comma. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
TS+EXTRA+
[edit]- 1 - C-MODEM - wikt:file .BAD: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 1 - CAI Format - wikt:ending .cai: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 2 - CD64 (Nintendo) - wikt:supports .v64, wikt:and .z64: software file suffixes. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 6 - CDemu - wikt:Creator .cif, wikt:WinOnCD .c2d, wikt:Modeller .ecm, wikt:gBurner .gbi, wikt:PowerISO .daa, wikt:and .toc: software file suffixes. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 1 - CNF - wikt:extension .cnf: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 2 - CP/M - wikt:translated .ASM, wikt:into .A86: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 1 - Caddie (CAD system) - wikt:ASCII .CEX: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 1 - Cadwork informatik AG - wikt:is .lxz: software file suffix. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 3 - Canadian Internet Registration Authority - wikt:was .kiw, wikt:gTLD .mls: software file suffixes. Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 1 - Cascading (software) - wikt:Cascading .jars: software file suffix (plural). Ira Leviton (talk) 17:56, 19 August 2020 (UTC)
- 3 - Chasys Draw IES - wikt:the .cd5, wikt:supporting .ggr, wikt:and .gra: software file suffixes. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 1 - Cheat Engine - wikt:extension .CT: software file suffix. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 2 - Chess opening book (computers) - wikt:s .ctg, wikt:s .abk: software file suffixes. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 1 - ChessV - wikt:in .cvc: software file suffixes. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 1 - ChordPro - wikt:or .cho: software file suffix. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 4 - Christian Hartinger - wikt:Ru(arene), wikt:metal(II), wikt:Am(m), wikt:am(m): chemistry terminology. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 1 - Château de Montségur - wikt:deBirmingham: a surname. Ira Leviton (talk) 16:39, 19 August 2020 (UTC)
- 1 - Citadel (software) - wikt:be .Read: explaining a software name. Ira Leviton (talk) 01:07, 19 August 2020 (UTC)
- 1 - Clinical Data Interchange Standards Consortium - wikt:as .OWL: a software file suffix. Ira Leviton (talk) 01:07, 19 August 2020 (UTC)
- 2 - Clip Studio Paint - wikt:extension .lip, wikt:extension .clip: a software file suffix. Ira Leviton (talk) 01:07, 19 August 2020 (UTC)
- 3 - Closed captioning - Games[CC], wikt:Captionate .XML, wikt:a .SCC: software file suffixes. Ira Leviton (talk) 01:07, 19 August 2020 (UTC)
- 2 - Clustal - wikt:with .aln, wikt:and .dnd: software file suffixes. Ira Leviton (talk) 01:07, 19 August 2020 (UTC)
- 2 - ColdFusion Markup Language - wikt:the .cfc, wikt:as .CFC: software file suffixes. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Combined Community Codec Pack - wikt:Video .nsv: software file suffix. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Comic book archive - wikt:or .cb7: software file suffix. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Commodore 64 peripherals - wikt:of .d64s: software file suffix. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 2 - Commodore D9060 - wikt:LOAD ,8, wikt:LOAD ,8: software coding. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Comparison of JavaScript engines (DOM support) - wikt:and .chOff: software file suffixes. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 3 - Comparison of e-book formats - wikt:Both .xeb, wikt:and .ceb, wikt:The .ibooks: software jargon and file suffixes. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 4 - Component Pascal - wikt:and .osf, wikt:uses .cp, wikt:and .cps, wikt:format .ocf: software sile suffixes. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 3 - Connected Data Objects - wikt:two .genmodel, wikt:load .ecore, wikt:to .genmodel: software jargon. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 1 - Conway group - wikt:Let .hkl: mathematical notation. Ira Leviton (talk) 20:03, 19 August 2020 (UTC)
- 3 - Creative Music File - wikt:and .cmf: software file suffix. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 2 - Criticism of Google - wikt:and .tld, wikt:and .tld: software file suffixes. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 13 - Crowds (anonymity network) - wikt:P(I, wikt:P(Hi), wikt:P(H, wikt:P(H, wikt:P(H, wikt:P(I, wikt:P(I, wikt:P(H, wikt:P(I, wikt:P(H, wikt:P(IH, wikt:P(I, wikt:P(I: parts of mathematical notations. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 1 - Crown Commercial Service - wikt:domain .gsi: software file suffix. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 1 - CryptMix - wikt:by .code: software file suffix. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 2 - Crystal Reports - wikt:is .rpt, wikt:only .rptr: software file suffix. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 1 - Csound - wikt:extension .csd: software file suffix. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
- 2 - Czech phonology - wikt:ˈ .ˌ, wikt:ˈ .ˌ: unclear. Ira Leviton (talk) 20:50, 19 August 2020 (UTC)
HB+
[edit]- 2 - CPC Binary Barcode - <tt>, </tt>: I can't figure out how to do this one – there's an embedded span code with colors. Ira Leviton (talk) 21:05, 11 August 2020 (UTC)
- 1 - Comet Records - <hr/> : short horizontal line. Ira Leviton (talk) 21:05, 11 August 2020 (UTC)
- 1 - Conqueror Records - <hr/>: short horizontal line. Ira Leviton (talk) 21:05, 11 August 2020 (UTC)
Cases with notes (C) from 2019-12-20 dump
[edit]T1+
[edit]- More dnd
- 2 - Chromatic dragon - wikt:chuuls, wikt:landwyrms: creatures in this game. Ira Leviton (talk) 01:30, 5 January 2020 (UTC)
- 4 - C&C 61 - wikt:El)iette, wikt:Is)abel, wikt:Ara)bel, wikt:iette (OK: name of the boat is an acronym of) leela52452 (talk)
- 11 - CMLL Super Viernes (May 2010) - (probably OK: wikt:rúdo, wikt:rúdo, wikt:rúdo, wikt:rúdo, wikt:rúdo, wikt:rúdos, wikt:rúdo, wikt:rúdo, wikt:rúdo, wikt:rúdos, wikt:rúdo) (note: term used in professional wrestling) leela52452 (talk)
- 2 - CMLL Torneo Nacional de Parejas Increíbles (2010) - (probably OK: wikt:rúdo, wikt:rúdo) (note: term used in professional wrestling) leela52452 (talk)
- 1 - Cadaver Tomb of René of Chalon - wikt:interrees (note: could not find info) leela52452 (talk)
- 1 - Cadi (Surselva) - wikt:cuorts - sursilvan for jurisdiction Strickesel (talk)
- 2 - Cadmia - wikt:calamitis wikt:ostrytis (note: OK: calamitis, ostrytis are terms used in preparation or process of cadmia) leela52452 (talk)
- 4 - Calabria - wikt:oceanized, wikt:rosamarina, wikt:scalidde, wikt:nzudda) rosamarina, scalidde, nzudda are dishes or food. oceanized - word related to geology. leela52452 (talk)
- 2 - Caladenia toxochila - wikt:toxon, wikt:cheilos toxon, cheilos are greek words leela52452 (talk)
- 1 - Calakmul - wikt:ajawob OK: k'ul ajawob, or holy kings. leela52452 (talk)
- 4 - Calamagrostis stricta - wikt:filiformed, wikt:filiformed, wikt:pilosed (probably OK: wikt:farinosed) filiformed, farinosed, pilosed -> describes the shape leela52452 (talk)
- 2 - Calotes pethiyagodai - wikt:nosilu, wikt:katussa Sinhala (local) name: Pethiyagodagë Nosilu Katussa leela52452 (talk)
- 1 - Calothamnus torulosus - wikt:phytographica OK: book name - Dissertatio phytographica de Regelia, Beaufortia et Calothamno leela52452 (talk)
- 1 - Calvary at Pleyben - wikt:kersanton rock name: La kersantite, ou pierre de Kersanton leela52452 (talk)
- 1 - Caladenia dilatata - wikt:koolin - the indigenous name for this plant Strickesel (talk)
- 1 - Calliostoma javanicum - wikt:costulated - seems to be a real word Strickesel (talk)
- 1 - Calochortus albus - wikt:laceolate - seems to be a real word Strickesel (talk)
- 1 - Calyptospora - wikt:decysts - should be a real word Strickesel (talk)
- 7 - Cambodian units of measurement - wikt:phyeam, wikt:phyeam, wikt:sesep, wikt:sesep, wikt:sesep, wikt:sesep, wikt:sesep - units of measurement Strickesel (talk)
- 5 - Cambridge Songs - wikt:neumed, wikt:funebrum, wikt:luscinio, wikt:perio, wikt:simphoniis - first is verb form of neume, rest is latin Strickesel (talk)
- 2 - Camorra - wikt:frieno - the name of a statute Strickesel (talk)
- 1 - Canadian women's ice hockey history - wikt:collegialism - seems to be okay Strickesel (talk)
- 1 - Candle (novel) - wikt:diskster - a term made up for this book Strickesel (talk)
- 2 - Cannibalism in popular culture - wikt:daedric - second is a term from skyrim Strickesel (talk) // I can't remember if that's one of the cases when daedric should be capitalised. daedric prince or Daedric prince? --Xurizuri (talk) 03:49, 23 January 2021 (UTC)
- 1 - Cantor (music software) - wikt:elicence OK: elicence dongle: electronic licence authenticator leela52452 (talk)
- 5 - Canzés dialect - wikt:cuut, wikt:adesinential, wikt:cuurt - first and third are words from that dialect, second might not be OK but I can't find the correct word Strickesel (talk)
- 3 - Canso (song) - wikt:capcaudadas, wikt:capfinidas, wikt:unissonans: Old Occitan (probably) words to describe Canso song structures --Xurizuri (talk) 06:17, 7 February 2021 (UTC)
- 1 - Capitulations of the Ottoman Empire - wikt:mouahed - could be okay Strickesel (talk)
- 1 - Caprinae - wikt:tsoan species name: tsoan caprids leela52452 (talk) // English language name for them --Xurizuri (talk) 03:49, 23 January 2021 (UTC)
- 2 - Carbonyldiimidazole - wikt:formylized (probably OK: wikt:triphenylalkelynephosphoranes) chemical names leela52452 (talk)
- 6 - Carbonatite - wikt:fenitization, wikt:vermiculte (probably OK: wikt:alvikite, wikt:rauhaugite, wikt:beforsite, wikt:lengaite) all terms related to Carbonatite leela52452 (talk)
- 8 - Carbon footprint - wikt:openLCA) openLCA Nexus -> website name leela52452 (talk)
- 3 - Cardiac neural crest complex - wikt:midotic, wikt:midotic, wikt:filopedia - seem to be correct Strickesel (talk)
- 1 - Carl Friedrich Schmidt (1832) - wikt:kuckers - estonian oil shale Strickesel (talk)
- 1 - Carl Heins - wikt:pianoesque - should be okay Strickesel (talk)
- 1 - Carnival of Tarazona de la Mancha - wikt:mascaruta - a costume Strickesel (talk)
- 2 - Carpal tunnel surgery - wikt:palamaris - a medical term Strickesel (talk)
- 1 - Carrier-sense multiple access with collision avoidance - wikt:desensing - could be okay Strickesel (talk)
- 1 - Carrycoats - wikt:cajr - brittonic Strickesel (talk)
- 1 - Carstairs - wikt:cajr
- 2 - Cash - wikt:faluce: from a language used on the Indian subcontinent, but I can't tell which language. Ira Leviton (talk) 21:26, 8 January 2020 (UTC)
- 1 - Caspian cobra - wikt:toxinological: the study of snake toxins. Ira Leviton (talk) 21:26, 8 January 2020 (UTC)
- 2 - Cat (Unix) - wikt:demoggification, wikt:argn: software jargon. Ira Leviton (talk)
- 1 - Central India Agency - wikt:sanads: an unspecified language from the Indian subcontinent. I can't tag it with the right language tag. Ira Leviton (talk) 18:06, 2 January 2020 (UTC)
- 1 - Centralizer and normalizer - wikt:xgx: part of a mathematical formula. Ira Leviton (talk) 18:06, 2 January 2020 (UTC)
- 1 - Changsha County - wikt:glutenite: a type of rock or ore. Ira Leviton (talk) 02:43, 3 January 2020 (UTC)
- 1 - Changzhou School of Thought - wikt:textological: arcane, but OK. Ira Leviton (talk) 02:43, 3 January 2020 (UTC)
- 2 - Channel NSW - wikt:ecoNSW, wikt:uTVstar: names of television shows. Ira Leviton (talk) 02:43, 3 January 2020 (UTC)
- 1 - Channel S - wikt:iRonniee: the names of a television show. Ira Leviton (talk) 02:43, 3 January 2020 (UTC)
- 1 - Chanté mas - wikt:lavwa: I'm not sure of this language. Ira Leviton (talk) 02:43, 3 January 2020 (UTC)
- 2 - Characterizations of the exponential function - wikt:limsups, wikt:nlna: mathematical jargon. Ira Leviton (talk) 22:26, 3 January 2020 (UTC)
- 4 - Chater's Annual - wikt:rettify, wikt:shuggar, wikt:raffil, wikt:tawker: all song lyrics or titles. Ira Leviton (talk) 05:10, 4 January 2020 (UTC)
- 1 - Chemical bonding of H2O - wikt:unhydridized: an arcane chemistry term. Ira Leviton (talk) 05:10, 4 January 2020 (UTC)
- 2 - Chemistry of photolithography - wikt:poly(cis, wikt:silated: chemistry terminology. Ira Leviton (talk) 05:10, 4 January 2020 (UTC)
- 1 - Cheri DiNovo - wikt:erying: written as "Qu(e)erying". Ira Leviton (talk) 05:10, 4 January 2020 (UTC)
- 1 - Cherubism - wikt:malocclusive: dental jargon. Ira Leviton (talk) 05:10, 4 January 2020 (UTC)
- 1 - Chief Keef discography - wikt:upreme: written as $supreme. Ira Leviton (talk) 16:46, 4 January 2020 (UTC)
- 1 - Chimurenga - wikt:reZhou: a name. Ira Leviton (talk) 16:46, 4 January 2020 (UTC)
- 2 - Christiane Reppe - (probably OK: wikt:handbiking, wikt:handbiking): these seem legitimate. Ira Leviton (talk) 01:30, 5 January 2020 (UTC)
- 2 - Chuck (engineering) - wikt:unchucking: an arcane engineering term. Ira Leviton (talk) 03:02, 5 January 2020 (UTC)
- 1 - Church of Nossa Senhora da Conceição (Santa Cruz das Flores) - wikt:polylobal: an architectural or geometrical term. Ira Leviton (talk) 03:02, 5 January 2020 (UTC)
- 2 - Church of Nossa Senhora dos Milagres (Corvo) - (probably OK: wikt:phytomorphic): an architectural term. Ira Leviton (talk) 03:02, 5 January 2020 (UTC)
- 1 - Circular permutation in proteins - wikt:favin: the name of a protein. Ira Leviton (talk) 07:31, 6 January 2020 (UTC)
- 1 - Circular reference - wikt:posn: software or math jargon. Ira Leviton (talk) 07:31, 6 January 2020 (UTC)
- 1 - Clade (novel) - wikt:clading: a process in this novel. Ira Leviton (talk) 02:27, 2 January 2020 (UTC)
- 1 - Clanculus undatus - wikt:monodont: part of the common name of this mollusk. Ira Leviton (talk) 02:27, 2 January 2020 (UTC)
- 1 - Clare Bell - wikt:hexapodal: this seems like an acceptable spelling. Ira Leviton (talk) 02:27, 2 January 2020 (UTC)
- 1 - Clavatula lelieuri - wikt:bicarinated: arcane, but legit. Ira Leviton (talk) 02:27, 2 January 2020 (UTC)
- 2 - Clean (programming language) - wikt:rgument, wikt:cleanlang: written as A(rgument) and software jargon, respectively. Ira Leviton (talk) 02:27, 2 January 2020 (UTC)
- 1 - Click letter - wikt:clickness: maybe not a real word, but it seems OK in context. Ira Leviton (talk) 01:58, 7 January 2020 (UTC)
- 1 - Cloudflare - wikt:cfnts: software jargon. Ira Leviton (talk) 01:58, 7 January 2020 (UTC)
- 6 - Coat Corporation - wikt:danGet, wikt:danGet, wikt:tarentos, wikt:scooop, wikt:danGet - "danGet" and "scooop" = proper names; "tarentos" - "tarento" is already plural and a linked WP article Ingratis (talk) 00:35, 8 January 2020 (UTC)
- 6 - Cobalt extraction - wikt:cobalt(II, wikt:nickel(II, wikt:cobalt(II, wikt:alamine - all chemical compounds Ingratis (talk) 00:35, 8 January 2020 (UTC)
- 1 - Colby Granger - wikt:the .45 - this is correct, I believe Strickesel (talk)
- 4 - Coldzera - wikt:felps, wikt:felps, wikt:zews, wikt:zews - names of gamers Strickesel (talk)
- 2 - Cole Hamels - wikt:at .272, wikt:under .500 - both are correct, I believe Strickesel (talk)
- 2 - Collect for Purity - wikt:unspekable, wikt:worthilich - both are some kind of Old English Strickesel (talk)
- 1 - College of Arms - wikt:scrivened - 'to use a Scrivener' Strickesel (talk)
- 2 - Colognian declension - wikt:your - translation of a pronoun of that dialect Strickesel (talk)
- 1 - Colombo crime family - wikt:a .357 - this is correct, I believe Strickesel (talk)
- 1 - Colorado River Numic language - wikt:pukku - a word in that language Strickesel (talk) // it looks like an attempt to do IPA. I've tagged it with {needs IPA} so someone can come and do it with the IPA template. --Xurizuri (talk) 06:17, 7 February 2021 (UTC)
- 1 - Combarbalá - wikt:combarbalita combarbalita - rock name leela52452 (talk)
- 6 - Combermere Abbey - wikt:edifie, wikt:your, wikt:you, wikt:your, wikt:your, wikt:your text on tablet leela52452 (talk)
- 4 - Common Operational Datasets - wikt:cperation, wikt:datatset (probably OK: wikt:cdatasets, wikt:datatsets) COD : Common Operational Datasets leela52452 (talk)
- 1 - Communist Party of India (Marxist–Leninist) People's War - wikt:dalams dalams (groups/units) leela52452 (talk)
- 1 - Community-acquired pneumonia - OK: wikt:nonpseudomonal) leela52452 (talk)
- 3 - Compendium of postage stamp issuers (Me–Mz) - wikt:parale, wikt:parale, wikt:novcic currency names leela52452 (talk)
- 1 - Compendium of postage stamp issuers (R) - wikt:parale leela52452 (talk)
- 7 - Complete partial order - wikt:cppos, wikt:…, wikt:… (probably OK: wikt:dcpos, wikt:dcpos, wikt:dcpos, wikt:dcpos) abbreviations leela52452 (talk)
- 7 - Composite Health Care System - wikt:with .NET computer language, (OK: wikt:iEHR, wikt:iEHR) abbreviation leela52452 (talk)
- 1 - Concordia Association - wikt:ahongs - seems to be a certain muslim person Strickesel (talk)
- 1 - Condom - wikt:spermicidally - legit, I think Strickesel (talk)
- 2 - Confessor (novel) - wikt:gobblies - a species in that book Strickesel (talk)
- 3 - Congruence lattice problem - wikt:i ,b, wikt:i ,z, wikt:i ,z - mathematical notations Strickesel (talk)
- 1 - Conquest of the Canary Islands - wikt:infernio - italian, I think Strickesel (talk)
- 1 - Constantin Virgil Gheorghiu - wikt:machinism - seems to be a real word Strickesel (talk)
- 1 - Content delivery network - wikt:mlytics - a brand name Strickesel (talk)
- 1 - Copyright symbol - wikt:accedents - seems to be correct Strickesel (talk)
- 2 - Cosplay - wikt:cameko, wikt:cameko - short form of 'camera kozo' Strickesel (talk)
- 2 - Cor Fuhler - wikt:keyolin: a musical instrument that's a combination keyboard and violin. Ira Leviton (talk) 21:56, 9 January 2020 (UTC)
- 6 - Coracora - wikt:Negritos(Entrance, wikt:festivitie, wikt:ofresen, wikt:resivio: I added 'which lang' tags. Ira Leviton (talk) 21:56, 9 January 2020 (UTC)
- 3 - Cordia sinensis - wikt:mnya, wikt:qoowe: names for this tree in local languages. Ira Leviton (talk) 21:56, 9 January 2020 (UTC)
- 29 - Cornish grammar - wikt:didn't, wikt:he's, wikt:here'll, wikt:you, wikt:kortos, wikt:wait.VN, wikt:ebost, wikt:ynno, wikt:ebost, wikt:you, wikt:wrug, wikt:venyn, wikt:venyn, wikt:gonnyk (probably OK: wikt:I'm, wikt:estyllen, wikt:fydh, wikt:danvenys, wikt:kedhlow, wikt:vydh, wikt:danvenys, wikt:gwelys, wikt:lowarth, wikt:gwelys, wikt:lowarth, wikt:dhodho, wikt:dhodho, wikt:vynnav, wikt:kewsel): all the contractions and non-English (i.e., Cornish) words are correct and used in examples. However, I don't (umm... do not) know how to label the Cornish words because there are different codes for Old, Middle, and Modern Cornish and my Cornish is... a little rusty. They probably can all be labelled 'cor' which is Modern Cornish and the ISO 639-2 code. Ira Leviton (talk) 21:56, 9 January 2020 (UTC) // it's written like it's describing a modern language (it uses present tense, it doesn't say when the language was superceded, and it doesn't compare it to the modern Cornish. --Xurizuri (talk) 06:17, 7 February 2021 (UTC)
- 2 - Corosync Cluster Engine - wikt:confdb (probably OK: wikt:coroipc): software jargon. Ira Leviton (talk) 21:56, 9 January 2020 (UTC)
- 1 - Cotton gin - wikt:churka - a type of gin Strickesel (talk)
- 2 - Count Fenring - wikt:heighliners - some kind of spaceship Strickesel (talk)
- 1 - County Sligo - wikt:bhFionn - an irish word Strickesel (talk)
- 10 - Court piece - wikt:bavney, wikt:baunie, wikt:baunie, wikt:baunie, wikt:bavney, wikt:bavney, wikt:bavney, wikt:bavney, wikt:bavney, wikt:baunie - a term in this game Strickesel (talk)
- 1 - Crash! (manga) - wikt:vomics = "voice comics" - add to Wikt Ingratis (talk) 00:46, 9 January 2020 (UTC)
- 2 - Crónica Electrónica - wikt:µo, wikt:roav - proper names Ingratis (talk) 00:35, 8 January 2020 (UTC)
- 2 - Cultured neuronal network - (probably OK: wikt:neurocages) - for Wikt Ingratis (talk) 01:39, 5 January 2020 (UTC)
- 9 - Curare - (probably OK: wikt:protocurarine, wikt:protocurine, wikt:protocuridine, wikt:electroplexy) - all for Wikt Ingratis (talk) 01:39, 5 January 2020 (UTC)
- 2 - Cypriot units of measurement - wikt:kartos (probably OK: wikt:gomari) - - both OK: should be in Wiktionary Ingratis (talk) 02:55, 2 January 2020 (UTC)
TS+COMMA+
[edit]- 1 - Cagayan - wikt:kayayan (note: not in wiktionary, it means river) leela52452 (talk)
- 1 - Call site - wikt:R14,SQR (not sure: seems to be part of code) leela52452 (talk)
- 1 - Calliostoma gemmulatum - (probably OK: wikt:lirulae) (did not find info - but found text "Mazatlan shells" archive.org : "In comparing the words used to describe sculpture (lirae, lirulae, striae, striul^e, &c.) with the same words in other books, they should often be interpreted as to the appearance of the shell under the micro- scope, generally with an inch- achromatic.") leela52452 (talk)
- 1 - Calliotropis pulchra - wikt:crenules (OK: Crenules - Small notches or beads. This glossary includes definitions for the technical terminology used in GLANSIS research. https://www.glerl.noaa.gov/glansis/glossary.html) leela52452 (talk)
- 1 - Captivity of Kodavas at Seringapatam - wikt:you: in a quotation. Ira Leviton (talk) 23:13, 12 January 2020 (UTC)
- 1 - Carbon-monoxide dehydrogenase (cytochrome b-561) - wikt:monoxide,water: an enzyme name, properly written without a space after the comma. Ira Leviton (talk) 23:13, 12 January 2020 (UTC)
- 4 - Caritas Don Bosco School - wikt:your, wikt:you, wikt:you, wikt:your: all in a poem. Ira Leviton (talk) 16:48, 12 January 2020 (UTC)
- 1 - Catalytically competent protonation state - wikt:Glu35H,Asp52: chemistry jargon. Ira Leviton (talk) 03:09, 14 January 2020 (UTC)
- 4 - Charmed - wikt:post)feminism: correctly written (part of a title) Ira Leviton (talk) 02:20, 18 January 2020 (UTC)
- 2 - Chiasmus - wikt:he's, wikt:she's: from a quotation. Ira Leviton (talk) 22:52, 18 January 2020 (UTC)
- 2 - China–Kazakhstan border - wikt:E014,G3018, wikt:E012,G30: road designations. Ira Leviton (talk) 03:45, 19 January 2020 (UTC)
- 3 - Chlorothalonil - wikt:hydroxy-2,5,6-trichloro-1,3-dicyanobenzene (probably OK: wikt:isophthalonitrile, wikt:tetrachloroisophthaloyl): chemical formulas. Ira Leviton (talk) 14:46, 19 January 2020 (UTC)
- 3 - Chortkov (Hasidic dynasty) - wikt:Sadigura,Kapishnitz, wikt:he's, wikt:she's - for "Moshe's" Ingratis (talk) 00:44, 20 January 2020 (UTC)
- 8 - Colon classification - wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs, wikt:Medicine,Lungs: writing in a classification system that does not use spaces after commas. Ira Leviton (talk) 14:48, 19 January 2020 (UTC)
- 1 - Common control physical channel - wikt:ch,256 - correct notation Strickesel (talk)
- 3 - Common pilot channel - wikt:ch,256, wikt:ch,256, wikt:ch,256 - correct notation Strickesel (talk)
- 4 - Comparison of TLS implementations - wikt:rsa,sha256, wikt:rsa,sha1, wikt:rsa,sha1, wikt:rsa,md5: software coding jargon. Ira Leviton (talk) 15:47, 19 January 2020 (UTC)
- 19 - Conflict resolution - wikt:exists,Strong, wikt:can't, wikt:haven't, wikt:doesn't, wikt:don't, wikt:your, wikt:you, wikt:you, wikt:you, wikt:your, wikt:your, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:your: some you/your are in quotations. Ira Leviton (talk) 15:47, 19 January 2020 (UTC)
- 2 - Conjugated linoleic acid - wikt:c9,t11, wikt:t10,c12: chemistry notation. Ira Leviton (talk) 15:47, 19 January 2020 (UTC)
- 1 - Controlled Substances Act - wikt:repressionistic - might be okay Strickesel (talk)
- 3 - Convex curve - wikt:q1,q2, wikt:q1,q2, wikt:s1,s2 - mathematical notations Strickesel (talk)
- 1 - Correspondence Theatre - wikt:uncommunicativity - should be okay Strickesel (talk)
- 24 - Cost-sharing mechanism - wikt:Alice,George, wikt:Alice,Both, wikt:George,Both, wikt:Alice,Both, wikt:George,Both, wikt:Payment(Alice, wikt:Cost(Both, wikt:Cost(Alice, wikt:Cost(George, wikt:Payment(George, wikt:Cost(Both, wikt:Cost(George, wikt:Cost(Alice, wikt:Payment(Alice, median[Cost, wikt:Cost(Both, wikt:Cost(Both, wikt:Cost(George, wikt:Payment(George, median[Cost, wikt:Cost(Both, wikt:Cost(Both, wikt:Cost(Alice, wikt:Payment(George - all valid mathematical notations Strickesel (talk)
- 2 - Countess Vaughn - wikt:how's, wikt:you - 'show's', in a quote Strickesel (talk)
- 1 - County Government of Nandi - wikt:murraming - seems to be correct Strickesel (talk)
- 2 - Cross-polarized wave generation - wikt:gr,XPW, wikt:gr,FW - seem to be correct physics notations Strickesel (talk)
- 1 - Crotonaldehyde - wikt:N'-tetramethyl-1,4-butenediamine - chemical notation Strickesel (talk)
- 4 - Culture of the Bahamas - wikt:yinna, wikt:you, wikt:your, wikt:your - from that dialect and explanations/translations Strickesel (talk)
- 1 - CuteCircuit - wikt:tshirtOS - a brand name Strickesel (talk)
- 1 - Cutman - wikt:sub)sulfate - written as (sub)sulfate Strickesel (talk)
- 2 - Cyclododecatriene - wikt:cis,trans, wikt:cis,trans - chemical notation Strickesel (talk)
- 1 - Cyclohexane conformation - wikt:Cis-1,4-Di-tert-butylcyclohexane - chemical notation Strickesel (talk)
- 4 - Cyclooctadecanonaene - wikt:cis,trans, wikt:cis,trans, methano[10, wikt:copper(II - all correct chemical notations Strickesel (talk)
- 1 - Cyclopropanone - wikt:trans-2,3-di-tert-butylcyclopropanone - chemical notation Strickesel (talk)
- 2 - César Alonso de las Heras - wikt:you (probably OK: wikt:I've) - both are part of the translation of a song title Strickesel (talk)
TS+EXTRA+
[edit]- 1 - Charles Alston - wikt:you - part of the title of a painting Strickesel (talk)
- 1 - Chen Chung Chang - wikt:ω ,3 - seems to be a mathematical notation Strickesel (talk)
- 1 - Classification of Clifford algebras - wikt:m ,C - seems to be a mathematical notation Strickesel (talk)
TS+BRACKETS+
[edit]- 1 - C10orf76 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 3 - C11H10 - Methano[10, Methano[10, Methano[10: part of a chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C15H21NO - wikt:tolyl)cyclohexanone: part of a chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C18 - wikt:cyclo(18: part of a chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 2 - C18H12CrN3O6 - wikt:Chromium(III, wikt:Chromium(III: parts of a chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C18H21NO2 - wikt:naphthyl)piperidine: part of a chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C1orf38 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - C21H23NO3 - wikt:Amylcinnamoyl)anthranilic: chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C22H12 - Benzo[ghi: chemical name. Ira Leviton (talk) 12:18, 27 January 2020 (UTC)
- 1 - C2orf54 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 4 - C3a (complement) - wikt:C3(H2O, wikt:C3(H2O, wikt:C3b(H2O, wikt:desarginine: chemistry notations.
- 2 - C4H16Cl3CoN4 - wikt:cobalt(III, wikt:cobalt(III: chemistry notation. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - C5orf45 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 2 - C8orf58 - wikt:tRNA(fMet: molecular biology notation. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - C9orf156 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CAPRIN2 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CAPZB - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CARD9 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CASIC HW-600 series UAV - wikt:HW(WJ: a model designation. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - CBC Sports - wikt:sublicenced: Canadian spelling. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - CBX1 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CBX7 (gene) - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 5 - CCC Tam Lee Lai Fun Memorial Secondary School - wikt:Religion(Christian, wikt:Science(Biology, wikt:Science(Biology, wikt:Education(Elective, wikt:Religion(Christian
- 1 - CCDC104 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CCDC137 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CCDC57 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CD97 - Ac[F2: part of molecular biology jargon. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 2 - CDH1 (gene) - wikt:PTPmu(PTPRM, wikt:PTPrho(PTPRT: molecular biology terminology. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 4 - CDP-ribitol ribitolphosphotransferase - wikt:poly(ribitol, wikt:poly(ribitol, wikt:teichoate, wikt:teichoate: parts of chemical names. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - CDS2 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CENPJ - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CENTG2 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CEPC - wikt:yl)indoline: chemistry notation. Ira Leviton (talk) 19:59, 27 January 2020 (UTC)
- 1 - CFB Toronto - wikt:RC(AIR: part of a Canadian Air Force designation. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - CHD7 - wikt:tm2a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CHD9 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CHF - wikt:Hafnium(IV: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CHRNA5 - wikt:hetero)pentamers left message on talk page about using (hetero)pentamers leela52452 (talk)
- 1 - CHST11 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 2 - CIB1 - wikt:alpha(IIb, wikt:alpha(IIb: molecular biology notation. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - CIR (gene) - wikt:tm3a(KOMP: molecular biology notation. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - CISH - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CLDN16 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CLJ Records - Visual[ism: the name of a music album. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - CLUAP1 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 3 - CMake - wikt:sub)directory, wikt:pcmaker, wikt:pcmaker: software jargon. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 2 - CN2 algorithm - wikt:Find_BestConditionExpression(TrainingSet, wikt:Find_BestConditionExpression(TrainingSet: software jargon. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - CNBC - wikt:Dis)Service: part of the name of a program on this channel. Ira Leviton (talk) 15:53, 27 January 2020 (UTC)
- 1 - COG2 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - COL24A1 - wikt:tm1b(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CONRAD (organization) - wikt:Development(USAID
- 1 - COO - wikt:Cobalt(II: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - COQ9 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - COSE - wikt:Cobalt(II: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CP Mainali - wikt:CPN(ML: abbreviation for Communist Party of Nepal, often written without a space. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CPI(ML) - wikt:CPI(ML: abbreviation for Communist Party of India, often written without a space. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CPN(ML) - wikt:CPN(ML: abbreviation for Communist Party of Nepal, often written without a space. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CPSF3 - wikt:tm1b(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 3 - CRAM-MD5 - wikt:md5(something_with_64_bytes, wikt:md5_internal(something_with_64_bytes, wikt:can't
- 1 - CRLF3 - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CRO - wikt:Chromium(II: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 2 - CSPD (molecule) - methoxyspiro[adamantane, wikt:yl)phenyl: both a parts of a chemical formula. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CSRP2BP - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CTR9 - wikt:tm1b(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CTTNBP2 - wikt:tm1b(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CUL4A - wikt:CRL4(Cdt2: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CUO - wikt:Copper(II: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 2 - CUSIP - wikt:modulo(10, wikt:modulo(sum: both are part of math jargon. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CUSO (disambiguation) - wikt:Copper(II: chemistry notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CYB561 - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CYB5R3 - wikt:CH3(CH2: part of a chemical formula. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - CYP2R1 - wikt:tm1b(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 2 - Cabtaxi number - wikt:Cabtaxi(10, wikt:Cabtaxi(10: mathematical notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 1 - Calabash Nebula - wikt:sin(angular: mathematical notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 4 - Calabash chalk - wikt:geophagical: this word seems legit. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calamine (mineral) - wikt:iron(III: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calcium chromate - wikt:chromium(III: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calcium disilicide - wikt:iron(II: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 2 - Calcium phosphate - wikt:E341(ii, wikt:E341(iii: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calcium selenide - wikt:indium(III: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calcium sulfate - wikt:cobalt(II: chemistry notation. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 1 - Calculator-Based Laboratory - wikt:expr(userin: software coding. Ira Leviton (talk) 05:00, 25 January 2020 (UTC)
- 3 - Calendar queue - month[11: software jargon. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 1 - Calibri - wikt:Luc(as: written deliberately as "Luc(as)". Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 2 - Calicene - wikt:calicenes: plural of the subject of the page. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 2 - California Shipbuilding Corporation - Co[mpany (probably OK: wikt:mpany): both correct, written deliberately to show errors. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 4 - California-Nevada-Hawaii District Key Club International - wikt:your, wikt:your, wikt:your, wikt:your: these are song lyrics. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 4 - Californium - wikt:californium(III, wikt:californium(III: chemistry notation. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 21 - Californium compounds - wikt:californium(III, wikt:californium(III, wikt:californium(III, wikt:californium(III, wikt:Californium(IV, wikt:californium(IV, wikt:californium(II, wikt:californium(II, wikt:Californium(IV, wikt:californium(III, wikt:Californium(III, wikt:Californium(III, wikt:Californium(IV, wikt:Californium(II, wikt:Californium(III, wikt:Californium(III, wikt:californium(III, wikt:Californium(III, wikt:californium(III, wikt:Californium(III, wikt:Californium(III
- 3 - Californium(III) polyborate - wikt:Californium(III, wikt:californium(III, wikt:californium(III: chemistry notation. Ira Leviton (talk) 00:59, 26 January 2020 (UTC)
- 1 - Camara v. Municipal Court of City and County of San Francisco - examin[ing: in a quotation, as "examin[ing]". Ira Leviton (talk) 23:06, 21 January 2020 (UTC)
- 1 - Cambridge Structural Database - wikt:yl)propan: part of a chemical name. Ira Leviton (talk) 23:06, 21 January 2020 (UTC)
- 4 - Camel (chess) - wikt:LW)b4, wikt:LW)e5, wikt:LW)b5 (probably OK: wikt:colorboundedness):chess terminology. Ira Leviton (talk) 23:06, 21 January 2020 (UTC)
- 3 - Camp Humphreys - wikt:Uplus(Mobile, wikt:shoppette, wikt:shoppette: a type of shop, possibly exclusive to military bases. Ira Leviton (talk) 23:06, 21 January 2020 (UTC)
- 1 - Candoluminescence - wikt:cerium(IV: chemistry jargon. Ira Leviton (talk) 19:51, 19 January 2020 (UTC)
- 1 - Candoxatril - wikt:mannopyranosyl)oxy: part of a chemical formula. Ira Leviton (talk) 19:51, 19 January 2020 (UTC)
- 3 - Cannabicyclohexanol - wikt:yl)phenol, wikt:yl)phenyl (probably OK: wikt:dimethyloctyl): parts of chemical formulas. Ira Leviton (talk)
- 1 - Canyon Diablo (meteorite) - wikt:iron(II: chemical notation. Ira Leviton (talk) 21:47, 19 January 2020 (UTC)
- 3 - Capacitor plague - wikt:aluminum(III: chemistry notation. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 3 - Capel Bond - exempl]ary, Ch]ristian, wikt:ristian: indicating letters that have been eroded on a grave marker. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 1 - Capsorubin - wikt:E160c(ii: a European food additive designation. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 4 - Carbene radical - wikt:cobalt(II, wikt:Cobalt(III, wikt:cobalt(III, wikt:cobalt(II: chemistry notation. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 1 - Carbon dioxide removal - wikt:NaOH(aq: chemistry notation. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 2 - Carbon-13 nuclear magnetic resonance - wikt:Cr(acac, wikt:Chromium(III
- 8 - Carbonate ester - wikt:poly(bisphenol, wikt:RO(CO, wikt:PhO(CO, wikt:PhO(CO, wikt:PhO(CO, wikt:PhO(CO, wikt:MeO(CO, wikt:Manganese(III: chemistry notations. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 2 - Carbonyl reduction - wikt:LiAl(OtBu, wikt:LiBH(Me: chemical formulas. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 3 - Carborundum Universal - wikt:Carbide(RbSiC, wikt:Zirconia(YPSZ, wikt:Zirconia(MgPSZ: chemical formulas. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 1 - Carboxymethyl cellulose - wikt:CMC(Na: chemical formula. Ira Leviton (talk) 15:49, 20 January 2020 (UTC)
- 1 - Cardiff (disambiguation) - wikt:What(ever: part of a song title. Ira Leviton (talk) 16:12, 20 January 2020 (UTC)
- 1 - Cardus Education Survey Canada - wikt:you: in a quotation. Ira Leviton (talk) 16:12, 20 January 2020 (UTC)
- 1 - Caridina apodosis - wikt:B1ab(iii: a criteria of the International Union for Conservation of Nature for evaluating endangered animals. Ira Leviton (talk) 16:12, 20 January 2020 (UTC)
- 1 - Caridina linduensis - wikt:B1ab(iii: ditto. Ira Leviton (talk) 16:12, 20 January 2020 (UTC)
- 1 - Carl Axel Arrhenius - wikt:Yttrium(III: chemistry notation. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 1 - Carl Franz Anton Ritter von Schreibers - wikt:Ni)3P: chemistry notation. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 2 - Carl Shipp Marvel - wikt:Poly(para: chemistry notation. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 1 - Carl Wilhelm Scheele - wikt:manganese(IV: chemistry notation. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 1 - Carl von Heyden - wikt:Georg(es: written that way, I assume because of some doubt about the proper form of the name. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 2 - Carlos Bulosan Theatre - wikt:Orient(ed: in the title of a play. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 1 - Carlos Cruz-Diez - wikt:In)formed: in the name of an art exhibition. Ira Leviton (talk) 19:56, 20 January 2020 (UTC)
- 1 - Carminite - wikt:lead(II: chemistry notation. Ira Leviton (talk) 02:43, 21 January 2020 (UTC)
- 1 - Carnitine biosynthesis - wikt:iron(II: chemistry notation. Ira Leviton (talk) 02:43, 21 January 2020 (UTC)
- 1 - Carnitine palmitoyltransferase II - wikt:tm1b(KOMP: chemistry notation. Ira Leviton (talk) 02:43, 21 January 2020 (UTC)
- 1 - Carnitine-acylcarnitine translocase - wikt:tm1a(EUCOMM: chemistry notation. Ira Leviton (talk) 02:43, 21 January 2020 (UTC)
- 1 - Carson High School (Carson, California) - wikt:flaggies: unclear. Ira Leviton (talk) 03:41, 26 January 2020 (UTC)
- 3 - Carstairs railway station - wikt:remarshalled - "remarshalled" is OK - Jkgree (talk) 18:59, 21 January 2020 (UTC)
- 1 - Carveol - wikt:yl)cyclohex: chemical notation. Ira Leviton (talk) 03:41, 26 January 2020 (UTC)
- 1 - Catalase - wikt:copper(II: chemical notation. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 2 - Catalogues of Fundamental Stars - wikt:FK6(III, wikt:FK6(III: abbreviation for a book title. Ira Leviton (talk)
- 2 - Catalysis - wikt:RhCl(PPh, wikt:lead(II: chemical notation. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 6 - Catalytic chain transfer - wikt:metha)acrylate, wikt:cobalt(II, wikt:Co(por, wikt:cobalt(II, wikt:cobalt(III, wikt:polymeryl: parts of chemical names and notations. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 3 - Catechol 1,2-dioxygenase - wikt:iron(III: chemical notation. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 4 - Catecholborane - wikt:tris(catecholato: part of a chemical name. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 1 - Category of relations - wikt:Rel(FA: mathematical notations. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 2 - Category of topological spaces - wikt:co)limits, wikt:co)limits: mathematical notations. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 2 - Category of topological vector spaces - wikt:co)complete, wikt:co)complete: mathematical notations. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 2 - Catellani reaction - wikt:arylpalladium(II, wikt:rhazinal: chemical names. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 2 - Cathy Henkel - wikt:you, wikt:you: part of a title. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 1 - Cativa process - wikt:iridium(III: chemical notation. Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 9 - Caturix - IN[ST: deliberately written, part of "IN[ST]ITVIT". Ira Leviton (talk) 01:25, 24 January 2020 (UTC)
- 1 - Cavalry tactics - wikt:kissaiers: I'm not sure of the language. Ira Leviton (talk) 03:08, 29 January 2020 (UTC)
- 2 - Cedros Island - (probably OK: wikt:megaherbivoreless): rephrased to megaherbivore. Ira Leviton (talk) 03:08, 29 January 2020 (UTC)
- 1 - Centaurin, alpha 1 - wikt:tm1a(EUCOMM: genetic jargon. Ira Leviton (talk) 16:15, 25 January 2020 (UTC)
- 1 - Center for Architecture and Design - wikt:Park(ing: part of a title.Ira Leviton (talk) 16:15, 25 January 2020 (UTC)
- 59 - Central Organising Committee, Communist Party of India (Marxist–Leninist) - wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:UCCRI(ML, wikt:CPI(ML, wikt:UCCRI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:UCCRI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML: abbreviatin for Communist Party of India (Marxist-Leninist) and other Marxist Leninist parties. Ira Leviton (talk) 19:50, 28 January 2020 (UTC)
- 2 - Central Organising Committee, Communist Party of India (Marxist–Leninist) (Umadhar Singh) - wikt:CPI(ML, wikt:COI(ML: ditto. Ira Leviton (talk) 19:50, 28 January 2020 (UTC)
- 4 - Central Organising Committee, Communist Party of India (Marxist–Leninist) Shantipal - wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML: ditto. Ira Leviton (talk) 19:50, 28 January 2020 (UTC)
- 14 - Central Reorganisation Committee, Communist Party of India (Marxist–Leninist) - wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:CPI(ML: ditto. Ira Leviton (talk) 19:50, 28 January 2020 (UTC)
- 5 - Centre of Communist Revolutionaries of India - wikt:UCCRI(ML, wikt:CPI(ML, wikt:CPI(ML, wikt:UCCRI(ML, wikt:CPI(ML: ditto. Ira Leviton (talk) 19:50, 28 January 2020 (UTC)
- 2 - Cephalosporin-C transaminase - wikt:oxopentanoyl)aminocephalosporinate, wikt:oxopentanoyl)aminocephalosporinate: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 13 - Ceramic glaze - wikt:Lead(II, wikt:lead(II, wikt:Lead(II, wikt:lead(II, wikt:Chromium(III, wikt:Chromium(III, wikt:Chromium(III, wikt:Chromium(VI, wikt:Chromium(VI, wikt:chromium(III, wikt:chromium(VI, wikt:chromium(VI: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Ceramic matrix composite - wikt:poly)crystalline: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Ceria-zirconia - wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerimetry - wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 2 - Cerium hydroxide - wikt:Cerium(III, wikt:Cerium(IV: chemistry notations. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 20 - Cerium nitrate - wikt:Cerium(III, wikt:cerium(III, wikt:cerium(III, wikt:cerium(III, wikt:diaquapentanitratocerate(III, wikt:Cerium(IV, wikt:cerium(IV, wikt:cerium(IV, wikt:cerium(IV, wikt:diaquapentanitratocerate(III, wikt:CeM(II, wikt:thallium(III: chemistry notations. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 4 - Cerium oxalate - wikt:Cerium(III, wikt:cerium(III, wikt:Cerium(III, wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 3 - Cerium oxide - wikt:Cerium(III, wikt:Cerium(III, wikt:Cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 10 - Cerium uranium blue - wikt:cerium(IV, wikt:uranium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:uranium(IV, wikt:cerium(IV, wikt:uranium(IV, wikt:cerium(IV, wikt:uranium(VI, wikt:cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerium(III) bromide - wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 6 - Cerium(III) carbonate - wikt:Cerium(III, wikt:cerium(III, wikt:cerium(III, wikt:Cerium(III, wikt:Cerium(III, wikt:cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 3 - Cerium(III) chloride - wikt:Cerium(III, wikt:Cerium(III, wikt:cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerium(III) fluoride - wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 2 - Cerium(III) hydroxide - wikt:Cerium(III, wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 4 - Cerium(III) iodide - wikt:Cerium(III, wikt:cerium(III, wikt:cerium(III, wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 4 - Cerium(III) methanesulfonate - wikt:Cerium(III, wikt:cerium(III, wikt:Cerium(III, wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 16 - Cerium(III) oxide - wikt:Cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:Cerium(III, wikt:tin(II, wikt:cerium(III, wikt:tin(II, wikt:Cerium(III, wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerium(III) sulfate - wikt:Cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 10 - Cerium(IV) oxide - wikt:Cerium(IV, wikt:Cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(IV, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 8 - Cerium(IV) oxide–cerium(III) oxide cycle - wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(III, wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerium(IV) sulfate - wikt:Cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Cerulean - wikt:cobalt(II: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 1 - Ceruletide - Tyr[SO: part of chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 2 - Cerussite - wikt:Lead(II: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 2 - Cha-La Head-Cha-La - mobi[le, re]make - written as mobi[le-re]make version Strickesel (talk)
- 1 - Chains (novel) - wikt:you - "saying please and thank you" Strickesel (talk)
- 1 - Chak 168/171 NB - wikt:Check(points - written as Check(points) Strickesel (talk)
- 7 - Chak 65 GB Mukandpur - wikt:numberdar, wikt:zarieay, wikt:razay, wikt:hasool (probably OK: wikt:numbardar, wikt:khalaq, wikt:alaahi) - they're probably all okay, but the text needs a complete rewrite anyway Strickesel (talk)
- 1 - Chakwal - wikt:sarpak - can't find info if typo Strickesel (talk)
- 1 - Chalcogenide glass - wikt:Gallium(III - chemical term Strickesel (talk)
- 1 - Chaldean Catholic Territory Dependent on the Patriarch of Jordan - wikt:Trans)Jordan - written as (Trans)Jordan Strickesel (talk)
- 2 - Challenge–response authentication - wikt:hash(cc, wikt:hash(sc - informatics notation Strickesel (talk)
- 2 - Chalybeate - wikt:Iron(II, wikt:Manganese(II - chemical terms Strickesel (talk)
- 2 - Chamavi - wikt:Ch)amavorum, wikt:amavorum - written as (Ch)amavorum Strickesel (talk)
- 14 - Champakesvara Siva Temple - wikt:apidha, wikt:jangha, wikt:jangha, wikt:amlaka, wikt:jangha, wikt:jangha, wikt:udyota (probably OK: wikt:patalaphuta, wikt:panchangabada, wikt:pabhaga, wikt:pabhaga, wikt:pabhaga, wikt:khapuri, wikt:pabhaga) - the article is filled with non-english words that probably just weren't translated. Should be looked over, but don't know the correct tag Strickesel (talk)
- 1 - Chantal Pontbriand - with[out - written as with[out] Strickesel (talk)
- 1 - Chaotic Wrestling - fed[eration - written as fed[eration] Strickesel (talk)
- 8 - Chapel of D. Fradique - wikt:MARG(ARID, wikt:VIC(ENT, wikt:ANT(ONI, wikt:AN)DO, wikt:AGESTA)DE, wikt:lebrus, wikt:lebrus (probably OK: wikt:caneletes) - first five are part of a seemingly correct latin inscription, last three might be a remnant from portuguese, but couldn't find actual translations Strickesel (talk)
- 2 - Chapelcross nuclear power station - wikt:MW(th, wikt:MW(th - written as MW(th), might be correct Strickesel (talk)
- 1 - Char siu - wikt:cha(zi - written as cha(zi) Strickesel (talk)
- 1 - Charlene James - wikt:Dad(die - a play, written as Dad(die) Strickesel (talk)
- 2 - Charles Albert III, Prince of Hohenlohe-Waldenburg-Schillingsfürst - wikt:Prince(ss, wikt:Prince(ss - written as prince(ss) Strickesel (talk)
- 1 - Charles Blackstone - wikt:Non)Fictions - (Non)Fictions, part of a title Strickesel (talk)
- 1 - Charles Bolden - wikt:VMA(AW - part of a plane name Strickesel (talk)
- 1 - Charles Boog Watson - wikt:FSA(Scot - FSA(Scot), might be okay Strickesel (talk)
- 1 - Charles Clews - wikt:mis)adventures - (mis)adventures Strickesel (talk)
- 1 - Charles Coulson - wikt:Alex(ander - Alex(ander) Strickesel (talk)
- 1 - Charles Dufour - wikt:parish(es - "respective parish(es)" Strickesel (talk)
- 2 - Charles Esche - wikt:co)curated - (co)curated Strickesel (talk)
- 2 - Charles Haros - wikt:Mis)naming, wikt:dovient - (Mis)naming; french Strickesel (talk)
- 1 - Charles Hunter Stewart - wikt:FSA(Scot - FSA(scot) Strickesel (talk)
- 1 - Charles L. Young Sr. - wikt:Vel(dore - Vel(dore) Strickesel (talk)
- 1 - Charles Lutz - wikt:CON)TEXT - (CON)TEXT, the name of an exhibition Strickesel (talk)
- 3 - Charm (programming language) - write_string[proc: software jargon. Ira Leviton (talk) 21:47, 1 February 2020 (UTC)
- 4 - Chelation - wikt:copper(II, wikt:Cu(en, wikt:Cu(MeNH: chemistry notation. Ira Leviton (talk) 21:47, 1 February 2020 (UTC)
- 7 - Chemical garden - wikt:cobalt(II, wikt:Copper(II, wikt:Chromium(III, wikt:Nickel(II, wikt:Iron(II, wikt:Iron(III, wikt:Cobalt(II: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 6 - Chemical oscillator - wikt:cerium(IV, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV, wikt:cerium(III, wikt:cerium(IV: chemistry notation. Ira Leviton (talk) 16:38, 28 January 2020 (UTC)
- 2 - Chemical substance - wikt:iron(II, wikt:Iron(II: chemistry notation. Ira Leviton (talk) 14:46, 30 January 2020 (UTC)
- 2 - Chemical transport reaction - wikt:iron(III, wikt:iron(III: chemistry notation. Ira Leviton (talk) 14:46, 30 January 2020 (UTC)
- 9 - Chemical vapor deposition of ruthenium - wikt:ruthenium(II, wikt:ruthenium(II, wikt:toluene)Ru, wikt:toluene)Ru, wikt:benzene)Ru, wikt:benzene)Ru, wikt:toluene)Ru, wikt:benzene)Ru: chemistry notation. Ira Leviton (talk) 14:46, 30 January 2020 (UTC)
- 2 - Chert - wikt:iron(III, wikt:eraillures: chemical notation and a plural geological term. Ira Leviton (talk) 05:25, 2 February 2020 (UTC)
- 1 - Chester Smith - Real]Music: [Real]Music is the name of an album. Ira Leviton (talk) 05:25, 2 February 2020 (UTC)
- 1 - Chevreul's salt - wikt:copper(II: chemical notation. Ira Leviton (talk) 05:25, 2 February 2020 (UTC)
- 2 - Chi-Ming Che - wikt:gold(III: chemical notation.
- 4 - Chichester inscription - DO[MVS, CO]GIDVBNI, MA]GNI, COLE]GIVM: as in an inscription. Ira Leviton (talk) 01:39, 4 February 2020 (UTC)
- 3 - Chichibabin pyridine synthesis - wikt:aluminium(III: chemical notation. Ira Leviton (talk) 01:39, 4 February 2020 (UTC)
- 1 - Chief Commission for the Prosecution of Crimes against the Polish Nation - wikt:Research(ing: looks like this is deliberate. Ira Leviton (talk) 01:39, 4 February 2020 (UTC)
- 1 - Chien-Shiung Wu - wikt:copper(II: chemistry notation. Ira Leviton (talk) 01:39, 4 February 2020 (UTC)
- 2 - Child custody laws in the United States - wikt:child(ren, wikt:child(ren: written this way to indicate both singular and plural. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 4 - Child support - wikt:child(ren, wikt:child(ren, wikt:child(ren, wikt:child(ren: written this way to indicate both singular and plural. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Children's Island Sanitarium - wikt:demand(ed: in a quotation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Children's Rights Council - wikt:child(ren: written this way to indicate both singular and plural. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 3 - Chilean Communist Party (Proletarian Action) - wikt:PC(AP, wikt:PC(AP, wikt:PC(AP: an abbreviation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- Chindon'ya - wikt:hatadori is OK, similar to: (probably OK: wikt:hyogoshi, wikt:hikifuda, wikt:hatamochi etc.)
- Chinese History: A New Manual - wikt:ecofactual - ecofactual materials (food/midden remains, soil samples, and vegetal material)
- Chiral Lewis acid - (not OK: wikt:dihydroxythioester, should be dihydroxy thioester)
- Chirnside - wikt:church(es - context is: church or churches
- Chirosathi - wikt:chatterjee_(durgapur_kuldiha - removed from article, appears to be vandalism
- Chittamuru Ramaiah - wikt:Madaras(Chennai - added space, noting Madras misspelled as Madaras, updated.
- Chittor Fort - wikt:jauhars, wikt:jauhars - article: Jauhar
- Chloro(cyclopentadienyl)bis(triphenylphosphine)ruthenium - wikt:RuCl(PPh, wikt:ruthenium(II, wikt:RuCl(PPh, wikt:ruthenium(III, wikt:ruthenium(II, wikt:tris(acetonitrile, wikt:ruthenium(II - chemistry spacing
- Chloro(dimethyl sulfide)gold(I) - wikt:sulfide)gold, wikt:sulfide)gold, wikt:gold(III, wikt:sulfide)gold - chemistry spacing
- Chloro(tetrahydrothiophene)gold(I) - wikt:Chloro(tetrahydrothiophene, wikt:tht)AuCl - chemistry spacing
- 4 - Chloro(triphenylphosphine)gold(I) - wikt:sulfide)gold: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 5 - Chloroauric acid - wikt:Au(bipy, wikt:gold(III, wikt:gold(III: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Chlorobis(ethylene)rhodium dimer - wikt:Rh(acac: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Chlorogenate—glucarate O-hydroxycinnamoyltransferase - wikt:hydroxycinnamoyl)transferase: part of the name of an enzyme. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 5 - Chloropentamminecobalt chloride - Cl]Cl, wikt:chloropentaamminecobalt(III, wikt:chloropentaamminecobalt(III, Cl]Cl: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Chlorophyll(ide) b reductase - wikt:Chlorophyll(ide: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Chloroplatinic acid - wikt:platinum(IV: chemistry notation. Ira Leviton (talk) 16:59, 3 February 2020 (UTC)
- 1 - Choline transporter - wikt:tm1a(KOMP: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 18 - Chordioid - wikt:Rawlins(2005, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordiods, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids, wikt:chordioids: plural of the subject of the page. Ira Leviton (talk) 00:21, 2 February 2020 (UTC)
- 1 - Chrau language - wikt:Chrau(also, wikt:presyllables: seems like a legitimate linguistic term. Ira Leviton (talk) 00:21, 2 February 2020 (UTC)
- 3 - Chris Slight - indie[dot, indie[dot, indie[dot: part of a title. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Christian Brassington - wikt:Five(ish: part of a title. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Christian Hebraist - wikt:Paul(us: correct. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Christian Thomsen Carl - wikt:Carl(son, wikt:Carl(son: written deliberately as "Carl(son)" because both names were used.
- 1 - Christine Harrison - wikt:rob(15: genetics terminology. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Christine S. Chow - wikt:platinum(II: chemistry notation. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Christoph Ernst Friedrich Weyse - wikt:Christoph(er: written deliberately as "Christoph(er)".
- 1 - Christopher Paudiß - wikt:Christoph(er: written deliberately as "Christop(er)". Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Christophor Vermishyan - wikt:Vermishyan(ts: written deliberately as "Vermishyan(ts)" to show pronunciation. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 5 - Chromate and dichromate - wikt:Chromium(VI, wikt:chromium(VI, wikt:chromium(III, wikt:iron(III: chemistry notation. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromate conversion coating - wikt:chromium(IV, wikt:iridite: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromate ester - wikt:chromium(VI, wikt:chromium(IV: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromated copper arsenate - wikt:copper(II, wikt:copper(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chrome alum - wikt:Chromium(III, wikt:chromium(III, wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chrome chalcedony - wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chrome orange - wikt:lead(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chrome yellow - wikt:lead(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium acetate - wikt:Chromium(II, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium chloride - wikt:Chromium(II, wikt:Chromium(III, wikt:Chromium(IV: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 4 - Chromium fluoride - wikt:Chromium(II, wikt:Chromium(III, wikt:Chromium(IV, wikt:Chromium(VI: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium hexacarbonyl - wikt:CpCr(CO: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium hexafluoride - wikt:chromium(VI: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium nitride - wikt:chromium(III, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 6 - Chromium oxide - wikt:Chromium(II, wikt:Chromium(III, wikt:chromium(IV, wikt:chromium(III, wikt:chromium(VI, wikt:Chromium(VI: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium pentafluoride - wikt:chromium(III, wikt:chromium(VI: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium sulfate - wikt:Chromium(II, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 15 - Chromium toxicity - wikt:chromium(III, wikt:chromium(VI, wikt:chromium(VI, wikt:chromium(VI, wikt:chromium(VI, wikt:chromium(III, wikt:chromium(III, wikt:Chromium(IV, wikt:chromium(III, wikt:chromium(III, wikt:chromium(III, wikt:chromium(III, wikt:Chromium(III, wikt:chromium(III: ditto Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 6 - Chromium trifluoride - wikt:Chromium(III, wikt:chromium(III, wikt:Chromium(III, wikt:chromium(III, wikt:Chromium(III, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 7 - Chromium(II) acetate - wikt:Chromium(II, wikt:chromium(II, wikt:copper(II, wikt:chromium(II, wikt:chromium(II, wikt:chromium(II, wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium(II) acetylacetonate - wikt:Chromium(II, wikt:chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(II) bromide - wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 5 - Chromium(II) chloride - wikt:Chromium(II, wikt:Chromium(II, wikt:chromium(III, wikt:chromium(II, wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 5 - Chromium(II) fluoride - wikt:Chromium(II, wikt:Chromium(II, wikt:chromium(II, wikt:chromium(III, wikt:chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(II) oxalate - wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium(II) oxide - wikt:Chromium(II, wikt:chromium(III, wikt:chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(II) selenide - wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(II) silicide - wikt:Chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 6 - Chromium(II) sulfate - wikt:Chromium(II, wikt:chromium(II, wikt:chromium(II, wikt:chromium(III, wikt:chromium(II, wikt:copper(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(III) 2-ethylhexanoate - wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium(III) acetate - wikt:Chromium(III, wikt:chromium(III, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 5 - Chromium(III) acetylacetonate - wikt:Chromium(III, wikt:Cr(acac, wikt:chromium(III, wikt:Cr(acac: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium(III) boride - wikt:Chromium(III, wikt:monoboride: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium(III) bromide - wikt:Chromium(III, wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(III) hydroxide - wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 4 - Chromium(III) iodide - wikt:Chromium(III, wikt:chromium(III, wikt:chromium(II: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium(III) nicotinate - wikt:Chromium(III, wikt:Chromium(III, wikt:chromium(III: ditto.
- 3 - Chromium(III) nitrate - wikt:Chromium(III, wikt:Chromium(III, wikt:chromium(III: ditto.
- 5 - Chromium(III) oxide - wikt:Chromium(III, wikt:Chromium(III, wikt:Chromium(III, wikt:chromium(III, wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 13 - Chromium(III) sulfate - wikt:Chromium(III, wikt:Chromium(III, wikt:chromium(III, wikt:chromium(III, wikt:chromium(II, wikt:chromium(III, wikt:chromium(III, wikt:chromium(VI, wikt:chromium(III, wikt:chromium(III, wikt:chromium(III, wikt:chromium(III, wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium(III) sulfide - wikt:Chromium(III, wikt:Chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(III) telluride - wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromium(IV) chloride - wikt:Chromium(IV, wikt:chromium(III: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromium(IV) fluoride - wikt:Chromium(IV: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 3 - Chromium(IV) oxide - wikt:chromium(IV, wikt:chromium(IV: ditto. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromo shadow domain - wikt:Su(var: part of a protein name. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 5 - Chromocene - wikt:chromium(II, wikt:chromium(III, wikt:chromium(II, wikt:chromium(II: chemical notation. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromoprotein - wikt:anthrozoa: a legit word. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 2 - Chromosome - wikt:idic(15: molecular biology jargon. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromosome 1 open reading frame 194 - wikt:poly(rC: molecular biology jargon. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chromosome instability - wikt:poly(ADP: molecular biology jargon. Ira Leviton (talk) 23:06, 25 January 2020 (UTC)
- 1 - Chu Lai Air Base - wikt:VMA(AW: part of a military abbreviation. Ira Leviton (talk) 18:00, 4 February 2020 (UTC)
- 3 - Chuck Jones filmography - wikt:24½th, wikt:24½th: parts of movie titles. Ira Leviton (talk) 18:00, 4 February 2020 (UTC)
- 1 - Chuping - wikt:iron(III: chemistry notation. Ira Leviton (talk) 18:00, 4 February 2020 (UTC)
- 1 - Churning (cipher) - wikt:TransformNibble(Y5: software coding. Ira Leviton (talk) 18:00, 4 February 2020 (UTC)
- 1 - Ciliary neurotrophic factor receptor - wikt:tm1a(EUCOMM: molecular biology notation. Ira Leviton (talk) 23:26, 26 January 2020 (UTC)
- 5 - Cinnabar - wikt:mercury(II, wikt:gallium(III, wikt:mercury(II, wikt:mercury(II, wikt:mercury(II: chemical notation. Ira Leviton (talk) 22:14, 4 February 2020 (UTC)
- 1 - Cinnabar (disambiguation) - wikt:mercury(II: chemical notation. Ira Leviton (talk) 22:14, 4 February 2020 (UTC)
- 2 - Circe chess - wikt:Rxe8(Ng8, wikt:wBf1(hidden: chess notation. Ira Leviton (talk) 22:14, 4 February 2020 (UTC)
- 1 - Circle packing - wikt:Sqrt(12: mathematical notation for square root. It probably should be in math font, which I don't know how to do well. Ira Leviton (talk) 22:14, 4 February 2020 (UTC)
- 2 - Circular ensemble - wikt:Sp(2n, wikt:Sp(2m: mathematical notation. It probably should be in math font, which I don't know how to do well. Ira Leviton (talk) 22:14, 4 February 2020 (UTC)
- 1 - Cis-Dichlorobis(bipyridine)ruthenium(II) - wikt:ruthenium(II: chemistry notation. Ira Leviton (talk) 19:28, 4 February 2020 (UTC)
- 1 - Cisplatin - wikt:PtCl(guanine: chemistry notation. Ira Leviton (talk) 19:28, 4 February 2020 (UTC)
- 1 - Citizen suit - trace[able: paraphrasing a quotation. Ira Leviton (talk) 19:28, 4 February 2020 (UTC)
- 2 - Claire Wong - wikt:wo(men - = wo(men) - intentional Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 3 - Clan Analogue - wikt:if)tek, wikt:if)tek, wikt:if)tek = B(if)tek - proper name Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 1 - Clara Ng - wikt:Un)Reality - = "(Un)Reality" - literary title Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 1 - Clarrie O'Shea - wikt:CPA(ML - ok Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 4 - Classical guitar with additional strings - BD]EADGBE = [BD]EADGBE - guitar string sequence Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 7 - Clathrochelate - wikt:tris(dioximate, wikt:cobalt(III, wikt:iron(II, wikt:cobalt(III = tris(dioximate), cobalt(III), iron(II), cobalt(III) - all OK chemical terms Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 4 - Claudius Hieronymianus - wikt:CL(audius, wikt:LEG(atus, wikt:LEG(ionis, wikt:VIC(tricis - expansions of abbreviations from Latin inscription Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 2 - Claus process - wikt:aluminum(III, wikt:titanium(IV = aluminum(III), titanium(IV) - correct chemical terms Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 1 - Claw-free graph - wikt:srg(27 = srg(27,16,10,8) - correct expression of graph parameters Ingratis (talk) 01:36, 31 January 2020 (UTC)
- 1 - Clinozoisite - wikt:iron(III =iron(III) - correct chemical term Ingratis (talk) 13:01, 31 January 2020 (UTC)
- 5 - Clipper architecture - wikt:d12(Rn, wikt:d32(Rn, wikt:d16(PC, wikt:d32(PC (probably OK: wikt:predecrement) - all OK except "pre decrement", which seems normally to be written as two words Ingratis (talk) 13:01, 31 January 2020 (UTC)
- 2 - Clonkeen College - Ho[use = "Ho[use]" Ingratis (talk) 00:00, 4 February 2020 (UTC)
- 1 - Clueless (House) - wikt:Tin(II = "Tin(II) - OK chemical term Ingratis (talk) 00:00, 4 February 2020 (UTC)
- 1 - Cnidoscolus stimulosus - wikt:stimul(us = mistaken break Ingratis (talk) 00:00, 4 February 2020 (UTC)
- 4 - Cob(II)alamin reductase - wikt:cob(II, wikt:cob(II, wikt:cob(II, wikt:cob(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 4 - Cob(II)yrinic acid a,c-diamide reductase - wikt:cob(II, wikt:cob(II, wikt:cob(II, wikt:cob(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt boride - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 2 - Cobalt chelatase - wikt:cob(II, wikt:cob(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 2 - Cobalt chloride - wikt:Cobalt(II, wikt:Cobalt(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 2 - Cobalt fluoride - wikt:Cobalt(II, wikt:Cobalt(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 3 - Cobalt green - wikt:cobalt(II, wikt:cobalt(II, wikt:chromium(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 3 - Cobalt oxide - wikt:Cobalt(II, wikt:Cobalt(III, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt phosphate - wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt sulfide - wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 5 - Cobalt(II) acetate - wikt:Cobalt(II, wikt:Cobalt(II, wikt:Co(salen: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 11 - Cobalt(II) bromide - wikt:Cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:bromopentaamminecobalt(III, wikt:cobalt(II, Br]Br, wikt:cobalt(II, wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 2 - Cobalt(II) carbonate - wikt:Cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 3 - Cobalt(II) chlorate - wikt:Cobalt(II, wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 2 - Cobalt(II) cyanide - wikt:Cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 10 - Cobalt(II) fluoride - wikt:Cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:Cobalt(II, wikt:Cobalt(II, wikt:Cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt(II) formate - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 13 - Cobalt(II) hydroxide - wikt:Cobalt(II, wikt:Cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:iron(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobaltate(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 6 - Cobalt(II) iodide - wikt:Cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 6 - Cobalt(II) nitrate - wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:hexaaquacobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt(II) oxalate - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 8 - Cobalt(II) oxide - wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt(II) phosphide - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Cobalt(II) selenide - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 4 - Cobalt(II) sulfate - wikt:Cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 5 - Cobalt(II,III) oxide - wikt:Cobalt(II, wikt:Cobalt(II, wikt:Cobalt(II, wikt:cobalt(II, wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 14 - Cobalt(III) chloride - wikt:Cobalt(III, wikt:cobalt(II, wikt:hexachlorocobaltate(III, wikt:cobalt(II, wikt:cobalt(III, wikt:cobalt(II, wikt:hexachlorocobaltate(III, wikt:cobalt(III, wikt:cobalt(III, wikt:cobalt(III, wikt:hexamminecobalt(III, wikt:cobalt(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 5 - Cobalt(III) fluoride - wikt:Cobalt(III, wikt:Cobalt(II, wikt:cobalt(II, wikt:cobalt(III, wikt:cobalt(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 4 - Cobalt(III) hydroxide - wikt:Cobalt(III, wikt:cobalt(II, wikt:cobalt(II, wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 7 - Cobalt(III) nitrate - wikt:Cobalt(III, wikt:Cobalt(III, wikt:Cobalt(III, wikt:cobalt(III, wikt:Cobalt(III, wikt:cobalt(II, wikt:Cobalt(III: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 3 - Cobaltocene - wikt:cobalt(II, wikt:cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Coccinite - wikt:mercury(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Coco3 - wikt:Cobalt(II: chemical notation. Ira Leviton (talk) 16:11, 4 February 2020 (UTC)
- 1 - Colin Baker - wikt:Five(ish - part of a title Strickesel (talk)
- 12 - Collagen, type II, alpha 1 - wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II, wikt:alpha1(II: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 6 - Collagen, type VI, alpha 1 - wikt:alpha1(VI, wikt:alpha2(VI, wikt:alpha3(VI, wikt:alpha2(VI, wikt:alpha3(VI, wikt:alpha1(VI: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 9 - Collagen, type XI, alpha 2 - wikt:alpha2(XI, wikt:alpha2(XI, wikt:alpha1(XI, wikt:alpha1(II, wikt:alpha2(XI, wikt:alpha2(XI, wikt:alpha2(XI, wikt:alpha2(XI, wikt:alpha2(XI: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 1 - Collagen, type XVII, alpha 1 - wikt:alpha1(XVII: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 10 - Collagen, type XXIII, alpha 1 - wikt:α1(XXIII, wikt:α1(XIII, wikt:α1(XXIII, wikt:α1(XXV, wikt:α1(XXIII, wikt:α1(XIII, wikt:α1(XXV, wikt:α1(XXIII, wikt:α1(XIII, wikt:α1(XXV: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 1 - Collins oxidation - wikt:chromium(VI: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 1 - Collins reagent - wikt:chromium(VI: chemistry notation. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 8 - Collision attack - wikt:hash(m1, wikt:hash(m2, wikt:hash(p1, wikt:hash(p2, wikt:hash(m1, wikt:hash(m2, wikt:hash(p1, wikt:hash(p2: software jargon. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 2 - Colneleate synthase - wikt:yloxy)non, yloxy]non: parts of chemical names. Ira Leviton (talk) 20:25, 4 February 2020 (UTC)
- 1 - Color appearance model - wikt:HPE(D65 - seems to be correct Strickesel (talk)
- 1 - Color of chemicals - wikt:vanadium(III - chemical notation Strickesel (talk)
- 1 - Colored gold - wikt:chromium(III - chemical notation Strickesel (talk)
- 3 - Colossally abundant number - wikt:nlog(log - mathematical notation Strickesel (talk)
- 1 - Colton High School (California) - wikt:USATF(United
- 1 - Colubridae - wikt:sub)families - seems correct Strickesel (talk)
- 1 - Combating Terrorism Center - wikt:Mis)Adventures - seems to be part of a title Strickesel (talk)
- 1 - Combination machine - wikt:Euro(pean - seems to be part of the name Strickesel (talk)
- 1 - Combustion analysis - wikt:Copper(II - chemical notation Strickesel (talk)
- 1 - Come What May - wikt:What(ever - part of a title Strickesel (talk)
- 1 - Cometabolism - wikt:cometabolising - the verb to this article Strickesel (talk)
- 1 - Commission on Genetic Resources for Food and Agriculture - deal[ing - in a quote Strickesel (talk)
- 1 - Commitment (Michael Wong album) - wikt:you - in a song title Strickesel (talk)
- 1 - Common operator notation - wikt:sin(2x - mathematical notation Strickesel (talk)
- 1 - Communist Control Act of 1954 - constitut[ed - in a quote Strickesel (talk)
- 5 - Communist Party of Estonia (1990) - wikt:platvormil, wikt:platvormil, wikt:platvormil, wikt:platvormil, wikt:platvormil - seems to be an estonian word Strickesel (talk)
- 1 - Communist Party of India (Marxist–Leninist) Janashakti - wikt:dalams - an indian word Strickesel (talk)
- 1 - Communist Party of India (Marxist–Leninist) Liberation - wikt:dalams - an indian word Strickesel (talk)
- 2 - Communist Party of the Philippines - wikt:re)creation, wikt:reaffirmist - both seem correct Strickesel (talk)
- 1 - Community of practice - wikt:re)negotiated - correct Strickesel (talk)
- 1 - Commutator - wikt:log(exp - mathematical notation Strickesel (talk)
- 1 - Comparative cultural studies - wikt:process(es - correct Strickesel (talk)
- 1 - Compare the Meerkat - wikt:Meer(kat - correct Strickesel (talk)
- 11 - Comparison of Internet forum software - wikt:sub)forums: (sub)forums. Strickesel (talk)
- 1 - Comparison of reference management software - wikt:re)formatting - correct Strickesel (talk)
- 1 - Comparison of vector graphics editors - wikt:ipelets - a real word, I think Strickesel (talk)
- 1 - Compendium of postage stamp issuers (Sc–Sl) - wikt:salungs - name of a currency Strickesel (talk)
- 1 - Complete category - wikt:pre)abelian - correct Strickesel (talk)
- 1 - Complex metal hydride - wikt:MgBr(THF - chemical notation Strickesel (talk)
- 1 - Complex multiplication - wikt:sub)ring - correct Strickesel (talk)
- 4 - Compounds of palladium(III) - wikt:palladium(III, wikt:Palladium(III, wikt:Pd(ttcn, wikt:dipalladium(III - chemical notations Strickesel (talk)
- 1 - Computational methods for free surface flow - wikt:div(cv - mathematical notation Strickesel (talk)
- 2 - Computer widow - wikt:widow(er, wikt:widow(er - correct Strickesel (talk)
- 2 - Concheros string instruments - wikt:Meca(tl, wikt:Huehue(tl - both correct Strickesel (talk)
- 1 - Concrete/Rage - wikt:Un)natural - correct Strickesel (talk)
- 1 - Concussions in American football - wikt:ethylidene)malononitrile - chemical notation Strickesel (talk)
- 2 - Condatis - Con[dati, wikt:aberau - first latin abbreviation, second probably okay Strickesel (talk)
- 1 - Condenser (optics) - wikt:lens(es - correct Strickesel (talk)
- 4 - Conductive polymer - wikt:co)polymerization, wikt:co)polymerization, wikt:co)polymerization, wikt:co)polymerization - all correct Strickesel (talk)
- 1 - Confession of 1967 - wikt:PC(USA - seems correct Strickesel (talk)
- 1 - Conformastatic spacetimes - wikt:Eqs(14 - correct Strickesel (talk)
- 3 - Congener (chemistry) - wikt:titanium(II, wikt:titanium(III, wikt:titanium(IV - chemical notation Strickesel (talk)
- 1 - Congo red - wikt:diyl)bis - chemical notation Strickesel (talk)
- 2 - Conjugal Rites - wikt:Gen(evieve, wikt:evieve - Gen(evieve) Strickesel (talk)
- 3 - Conjugated microporous polymer - wikt:Ni(cod, wikt:alkynl, wikt:ionothermal - all part of chemical names Strickesel (talk)
- 4 - Conjunctive query - wikt:attends(student, wikt:gender(student, wikt:gender(student2, wikt:lives(student - computer science notation Strickesel (talk)
- 1 - Conseil scolaire Viamonde - wikt:conseillers(ères - correct, I think Strickesel (talk)
- 1 - Conseil scolaire de district du Grand Nord de l'Ontario - wikt:conseillers(ères - correct, I think Strickesel (talk)
- 1 - Conseil scolaire de district du Nord-Est de l'Ontario - wikt:conseillers(ères - correct, I think Strickesel (talk)
- 4 - Conservation and restoration of frescos - wikt:iron(III, wikt:iron(III, wikt:lead(II, wikt:amphorous - chemical notations and real words, I think Strickesel (talk)
- 1 - Consolas - wikt:Luc(as - correct Strickesel (talk)
- 4 - Constant spectrum melody - wikt:sin(2π, wikt:sin(2π, wikt:sin(2πft, wikt:cos(2πεt - mathematical notations Strickesel (talk)
- 3 - Constantin Mille - Gh[eorghe, wikt:eorghe, wikt:partidului - first is written as Gh[eorghe], last is part of a title Strickesel (talk)
- 1 - Consumed scrubfowl - wikt:BM(NH: "(specimen BM(NH) 1988.4.3)" so I'm guessing this is the classification for it at that museum .
- 1 - Consumer Culture - wikt:work(er - correct Strickesel (talk)
- 1 - Contact (law) - wikt:child(ren - correct Strickesel (talk)
- 3 - Continent pass - wikt:air)pass, wikt:air)pass, wikt:air)pass - correct Strickesel (talk)
- 1 - Continuing Anglican movement - wikt:parish(es - correct Strickesel (talk)
- 1 - Continuously variable slope delta modulation - wikt:re)synchronization - correct Strickesel (talk)
- 2 - Control(human, data, sound) - wikt:control(human, wikt:control(human - the title of the performance Strickesel (talk)
- 3 - Convallatoxin - yl]oxy, wikt:mannopyranosyl)oxy, wikt:enolide - part of a chemical notation Strickesel (talk)
- 1 - Convention on preventing and combating violence against women and domestic violence - wikt:Rec(2002 - the name of a recommendation Strickesel (talk)
- 1 - Conversation theory - wikt:Ap(Con - a mathematical (I think) notation Strickesel (talk)
- 1 - Conway Stewart - wikt:'round - don't know how this is wrong Strickesel (talk)
- 2 - Coolpad - Fab[ulous, wikt:ulous - changed to Fab(ulous) Strickesel (talk)
- 2 - Coordination number - wikt:cobalt(II, wikt:ligancy - chemical notation, a real word Strickesel (talk)
- 1 - Coordination sphere - wikt:hexamminecobalt(III - chemical notation Strickesel (talk)
- 3 - Copper aspirinate - wikt:Copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper benzoate - wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 1 - Copper bromide - wikt:Copper(II - chemical notation Strickesel (talk)
- 1 - Copper carbonate - wikt:Copper(II - chemical notation Strickesel (talk)
- 1 - Copper chloride - wikt:Copper(II - chemical notation Strickesel (talk)
- 2 - Copper chromite - wikt:copper(II, wikt:sebacion - chemical notation, second is probably a real word Strickesel (talk)
- 2 - Copper coulometer - wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 1 - Copper fluoride - wikt:Copper(II - chemical notation Strickesel (talk)
- 2 - Copper ibuprofenate - wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 3 - Copper monosulfide - wikt:copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 1 - Copper nanoparticle - wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper oxide - wikt:Copper(II, wikt:Copper(III - chemical notation Strickesel (talk)
- 2 - Copper peptide GHK-Cu - wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 1 - Copper phosphate - wikt:Copper(II - chemical notation Strickesel (talk)
- 1 - Copper sulfate - wikt:Copper(II - chemical notation Strickesel (talk)
- 2 - Copper(I) bromide - wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 4 - Copper(I) chloride - wikt:copper(II, wikt:mercury(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 5 - Copper(I) cyanide - wikt:copper(II, wikt:copper(II, wikt:copper(II, Li[RCuCN, Li[RCuCN - chemical notation Strickesel (talk)
- 1 - Copper(I) fluoride - wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(I) hydroxide - wikt:iron(II, wikt:copper(II - chemical notation Strickesel (talk)
- 3 - Copper(I) iodide - wikt:copper(II, wikt:copper(II, wikt:palladium(II - chemical notation Strickesel (talk)
- 6 - Copper(I) oxide - wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(I) sulfate - wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 5 - Copper(I) thiocyanate - wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 10 - Copper(II) acetate - wikt:Copper(II, wikt:copper(II, wikt:Copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(II) acetylacetonate - wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(II) azide - wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 6 - Copper(II) bromide - wikt:Copper(II, wikt:Copper(II, wikt:Copper(II, wikt:Copper(II, wikt:Copper(II, wikt:Copper(II - chemical notation Strickesel (talk)
- 8 - Copper(II) fluoride - wikt:Copper(II, wikt:Copper(II, wikt:copper(II, wikt:Copper(II, wikt:Copper(II, wikt:Copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 3 - Copper(II) glycinate - wikt:Copper(II, wikt:copper(II, wikt:Cu(glycinate - chemical notation Strickesel (talk)
- 10 - Copper(II) nitrate - wikt:Copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(II) perchlorate - wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 3 - Copper(II) phosphate - wikt:Copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 4 - Copper(II) selenite - wikt:Copper(II, wikt:Copper(II, wikt:copper(II, wikt:Copper(II - chemical notation Strickesel (talk)
- 2 - Copper(II) tetrafluoroborate - wikt:Copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 2 - Copper(II) triflate - wikt:copper(II, wikt:rhodium(II - chemical notation Strickesel (talk)
- 4 - Copper(III) oxide - wikt:Copper(III, wikt:Copper(III, wikt:Copper(III, wikt:hexafluorocuprate(III - chemical notation Strickesel (talk)
- 2 - Copperas works - wikt:Iron(II, wikt:iron(II - chemical notation Strickesel (talk)
- 4 - Copper–copper(II) sulfate electrode - wikt:copper(II, wikt:copper(II, wikt:copper(II, wikt:copper(II - chemical notation Strickesel (talk)
- 1 - Corcovado National Park - wikt:jolillo - some type of forest Strickesel (talk)
- 3 - Core–shell semiconductor nanocrystal - wikt:unpassivated, wikt:unpassivated, wikt:unpassivated - a real word Strickesel (talk)
- 2 - Corita Kent - wikt:ad)ical, wikt:your - R(ad)ical, and second part of a title Strickesel (talk)
- 3 - Corium (nuclear reactor) - wikt:indium(III, wikt:neodymium(III, wikt:chromium(III - chemical notations Strickesel (talk)
- 6 - Cornelia Supera - CORNEL[IA, AVG[VSTA, CORNEL[IA, AVG[VSTA, COR[NELIA, AV[GVSTA - latin abbreviations Strickesel (talk)
- 1 - Cornelis Jan Witsen - wikt:Witsz(en - correct Strickesel (talk)
- 1 - Corneliu Coposu - wikt:in)famous - correct Strickesel (talk)
- 2 - Cornelius Cardew - Hat[Now, Hat[Now - seem to be part of a title Strickesel (talk)
- 1 - Cornell Big Red Pep Band - wikt:in)famous - correct Strickesel (talk)
- 1 - Coronagraph - wikt:vector(ial - correct Strickesel (talk)
- 2 - Coronaviridae - wikt:glyco)protein, wikt:letovirus - first is intentional, second part of a name Strickesel (talk)
- 2 - Coronene - benzo[10, bc]coronene - part of a chemical notation Strickesel (talk)
- 1 - Correns - wikt:Bio(logique - correct Strickesel (talk)
- 7 - Cortinarius violaceus - wikt:iron(III, wikt:µm, wikt:µm, wikt:µm, wikt:µm, wikt:µm, wikt:µm - first is correct, second could not figure out how to use unicode Strickesel (talk)
- 1 - Cortney Lance Bledsoe - wikt:_____(Want - seemingly a title of poetry Strickesel (talk)
- 1 - Corvallis High School (California) - wikt:cor(da - seems correct Strickesel (talk)
- 4 - Cosmopterix - wikt:sub)costal, wikt:sub)dorsal, wikt:sub)costal, wikt:sub)dorsal - all correct Strickesel (talk)
- 3 - Costa Grande of Guerrero - wikt:tortugeros (probably OK: wikt:enchhistoria, wikt:sociorural) - first is correct, I believe, other two I deleted because they made no sense with the context Strickesel (talk)
- 7 - Costa Rica national football team results (2010–19) - wikt:Coach(es, wikt:Coach(es, wikt:Coach(es, wikt:Coach(es, wikt:Coach(es, wikt:Coach(es, wikt:Coach(es - all correct Strickesel (talk)
- 5 - Costoboci - wikt:FIL(iae, wikt:CARISS(imae, wikt:FECER(unt, wikt:kʷek̂, wikt:kʷōk̂ - first three latin inscriptions, last two don't know how to fix Strickesel (talk)
- 2 - Cotunnite - wikt:lead(II, wikt:sofiite - all correct Strickesel (talk)
- 1 - Council of the European Union - wikt:con)formations - correct Strickesel (talk)
- 2 - Counter-IED efforts - (probably OK: wikt:emplacer) - not sure if okay Strickesel (talk)
- 1 - Counting sort - count[key - correct Strickesel (talk)
- 3 - Country of origin - OFFI[ci, LIQU[minis, SCOM[bri - latin inscriptions Strickesel (talk)
- 4 - Coverage map - wikt:VHF(FM, wikt:VHF(FM, wikt:µV/m, wikt:µV/m - first two correct, last two don't know how to fix Strickesel (talk)
- 2 - Cowbridge Grammar School - wikt:auto)biographies, wikt:your - first is correct, second part of a title
- 2 - Craniofrontonasal dysplasia - wikt:trans)membrane - (trans)membrane Strickesel (talk)
- 1 - Creativity and mental health - wikt:hypo)mania - (hypo)mania Strickesel (talk)
- 1 - Credit River - wikt:overpass(es - overpass(es) Strickesel (talk)
- 1 - Crichtonpelta - wikt:quadrato)jugal - (quadrato)jugal Strickesel (talk)
- 1 - Crime of passion - wikt:Rec(2002 - Rec(2002)5, the name of a recommendation of the council of europe Strickesel (talk)
- 1 - Crimean Tatar language - wikt:sub)groups - (sub)groups Strickesel (talk)
- 1 - Crimp - wikt:Crimp(ing - Crimp(ing) Strickesel (talk)
- 1 - Crisaborole - wikt:yl)oxy - part of a chemical notation Strickesel (talk)
- 2 - Crocoite - wikt:lead(II, wikt:crocoise - first is a chemical notation, second is the original name Strickesel (talk)
- 2 - Crofelemer - wikt:epi)catechin, wikt:epi)gallocatechin - chemical notations Strickesel (talk)
- 4 - Cross electrophile coupling - wikt:diorganonickel(III, wikt:pseudo)halide, wikt:nickel(II, wikt:palladium(II - chemical notations Strickesel (talk)
- 1 - Crossmyloof - wikt:Ma)lieu - (Ma)lieu, a possible name origin Strickesel (talk)
- 1 - Crossoona Rath - wikt:semi)historical - (semi)historical Strickesel (talk)
- 11 - Crossover experiment (chemistry) - wikt:Pd(dppe, wikt:Pd(transphos, wikt:Pd(dppe, wikt:Pd(PPh, wikt:Pd(transphos, wikt:Pd(transphos, OH]isocitrate, wikt:transphos, wikt:transphos, wikt:transphos, wikt:transphos - all part of chemical notations Strickesel (talk)
- 2 - Crosswind - wikt:sin(45, wikt:cos(45 - mathematical notation Strickesel (talk)
- 1 - Crossworlds - wikt:Joe(seph - Joe(seph) Strickesel (talk)
- 1 - Crotalus pusillus - wikt:B1ab(iii - a classification Strickesel (talk)
- 1 - Crotalus stejnegeri - wikt:B1ab(iii - a classification Strickesel (talk)
- 1 - Crotonic acid - wikt:mercury(II - chemical notation Strickesel (talk)
- 2 - CrushFTP Server - wikt:FTP(ES, wikt:FTP(ES - correct Strickesel (talk)
- 1 - Cry (disambiguation) - wikt:Cry(ing - correct Strickesel (talk)
- 1 - Cryptmount - wikt:un)mounted - correct Strickesel (talk)
- 5 - Cubix - wikt:robotist - should be a word Strickesel (talk)
- 2 - Culture of Algeria - wikt:chtitha, wikt:liberately - first is some kind of food, second unsure what was meant Strickesel (talk)
- 1 - Culture of Palestine - wikt:kinafe - a middle-eastern dessert Strickesel (talk)
- 14 - Cuprate - wikt:copper(III, wikt:copper(II, wikt:copper(II, wikt:copper(III, wikt:copper(IV, wikt:Copper(II, wikt:trichlorocuprate(II, wikt:tetrachlorocuprate(II, wikt:pentachlorocuprate(II, wikt:copper(II, wikt:copper(III, wikt:copper(IV, wikt:hexafluorocuprate(III, wikt:hexafluorocuprate(IV - chemical notation Strickesel (talk)
- 1 - Cupriavidus metallidurans - wikt:gold(III - chemical notation Strickesel (talk)
- 1 - Curium(III) fluoride - wikt:Curium(III - chemical notation Strickesel (talk)
- 1 - Customer (Dis)Service - wikt:Dis)Service - correct Strickesel (talk)
- 2 - Cyanate - wikt:Rh(PPh, wikt:Rh(PPh - chemical notation Strickesel (talk)
- 3 - Cyanocobalamin reductase (cyanide-eliminating) - wikt:cyanocob(III, wikt:cyanocob(III, wikt:cyanocob(III - chemical notation Strickesel (talk)
- 4 - Cyanonickelate - wikt:Tetracyanonickelate(II, wikt:tetracyanonickelate(III, wikt:Tetracyanonickelate(III, wikt:hexacyanonickelate(III - chemical notation Strickesel (talk)
- 4 - Cyanotype - wikt:iron(III, wikt:iron(II, wikt:iron(II, wikt:iron(III - chemical notation Strickesel (talk)
- 3 - Cyclic homology - wikt:co)homology, wikt:co)homology, wikt:co)homology - correct Strickesel (talk)
- 1 - Cyclin E - wikt:p220(NPAT - chemical notation Strickesel (talk)
- 2 - Cyclin E2 - wikt:p27(Kip1, wikt:p21(Cip1 - chemical notation Strickesel (talk)
- 1 - Cyclin-dependent kinase 4 - wikt:p16(INK4a - chemical notation Strickesel (talk)
- 2 - Cyclo(18)carbon - cyclo[18, Cyclo[18 - chemical notation Strickesel (talk)
- 2 - Cycloaddition - wikt:pyridyl)ethene, Iron[pyridine - chemical notation Strickesel (talk)
- 1 - Cyclobis(paraquat-p-phenylene) - wikt:methoxyethoxy)ethoxy - chemical notation Strickesel (talk)
- 1 - Cyclocarbon - Cyclo[18 - chemical notation Strickesel (talk)
- 3 - Cyclodecapentaene - methano[10, tricyclic[10, tricyclic[10 - chemical notation Strickesel (talk)
- 1 - Cyclohexa-1,3-diene - wikt:Benzene)ruthenium - chemical notation Strickesel (talk)
- 1 - Cyclonic separation - wikt:air)flow - correct Strickesel (talk)
- 6 - Cyclooctadiene rhodium chloride dimer - wikt:RhCl(COD, wikt:RhCl(COD, wikt:RhCl(COD, wikt:RhCl(COD, wikt:RhCl(COD, wikt:Rh(COD - chemical notation Strickesel (talk)
- 3 - Cyclooctatetraene - wikt:mercury(II, wikt:Fe(COT, wikt:Fe(COT - chemical notation Strickesel (talk)
- 1 - Cyclopentadiene - wikt:nickel(II - chemical notation Strickesel (talk)
- 3 - Cyclopentadienyl allyl palladium - wikt:Pd(CNR, wikt:CpPd(allyl, wikt:Pd(PR - chemical notation Strickesel (talk)
- 1 - Cyclopentadienylchromium tricarbonyl dimer - wikt:CpCr(CO - chemical notation Strickesel (talk)
- 1 - Cyclopentadienyliron dicarbonyl iodide - wikt:CpFe(CO - chemical notation Strickesel (talk)
- 1 - Cyclopentamine - wikt:meth)amphetamine - chemical notation Strickesel (talk)
- 1 - Cycloprop-2-ene carboxylic acid - wikt:oyl)oxazolidinones - chemical notation Strickesel (talk)
- 1 - Cyclotomic unit - wikt:exp(2πia - mathematical notation Strickesel (talk)
- 4 - Cyrrhus - wikt:arch)bishopric, wikt:Arch)Bishops, wikt:Cyrrhen(sis, wikt:Cyrrhen(sis - both correct Strickesel (talk)
- 2 - Cytochrome P450 engineering - wikt:Ir(Me, wikt:Ir(Me - part of a chemical notation Strickesel (talk)
- 3 - Cytochrome c oxidase - wikt:Tyr(244, wikt:His(240, wikt:Tyr(244 - part of a chemical notation Strickesel (talk)
- 2 - Cytochrome d - ubiquinol[inner, ubiquinone[inner - part of a chemical notation Strickesel (talk)
- 1 - Cytogenetics - wikt:CLSp(CG - seems intentional Strickesel (talk)
- 1 - Cúcuta - wikt:clemones - apparently a type of tree Strickesel (talk)
Case notes (D) from 2020-08-01 dump
[edit]T1+
[edit]- 1 - DMSO reductase - wikt:dorC: the name of a gene. Ira Leviton (talk) 15:49, 2 September 2020 (UTC)
- 3 - DNA barcoding in diet assessment - wikt:trnL, wikt:trnL, wikt:trnL: names of genes. Ira Leviton (talk) 15:49, 2 September 2020 (UTC)
- 7 - DNA repair protein XRCC4 - wikt:V(D), wikt:V(D), wikt:V(D), wikt:V(D), wikt:V(D), p]harmacological, wikt:harmacological: molecular biology jargon and brackets to clarify a quotation. Ira Leviton (talk) 15:49, 2 September 2020 (UTC)
- 1 - DNA virus - wikt:bipartate: a biology term. Ira Leviton (talk) 15:49, 2 September 2020 (UTC)
- 3 - DNA-3-methyladenine glycosylase - wikt:a(EUCOMM): part of a molecular biology term. Ira Leviton (talk) 15:49, 2 September 2020 (UTC)
- 5 - Da (Indic) - wikt:ddra, wikt:ddva, wikt:ndva, wikt:ndya, wikt:rdra: I don't know enough about Indic script to figure out the proper language tags. Ira Leviton (talk) 17:33, 2 September 2020 (UTC)
- 1 - Dagestan - wikt:koisy: probably a Russian transliteration. Ira Leviton (talk) 17:33, 2 September 2020 (UTC)
- 4 - Dagga - wikt:daggha, wikt:dachka, wikt:twaga, wikt:toaga: different ways of spelling the subject of the page in other languages, but the languages are not mentioned. Ira Leviton (talk)
- 1 - Dahl's toad-headed turtle - wikt:pect: an abbreviation, possibly pectoral or something similar. Ira Leviton (talk) 17:33, 2 September 2020 (UTC)
- 2 - Dahlbominus fuscipennis - wikt:eonymph: a stage in the development of some insects. Ira Leviton (talk) 17:33, 2 September 2020 (UTC)
- 1 - Dakacha - wikt:maengo: unclear language. Ira Leviton (talk) 13:12, 3 September 2020 (UTC)
- 1 - Daldøs - wikt:undalled]]: an in-universe term. Ira Leviton (talk) 20:35, 3 September 2020 (UTC)
- 1 - Damian Woetzel - wikt:RE(NEW): an acronym. Ira Leviton (talk) 20:35, 3 September 2020 (UTC)
- 1 - Dar (disk archiver) - wikt:gdar: software jargon. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 25 - Darboux frame - wikt:ωi,ωij, wikt:ωi,ωji, wikt:P(s), wikt:P(s, wikt:F(n), wikt:F(n), wikt:Euc(n), wikt:F(n), wikt:Euc(n), wikt:F(n), wikt:F(n), wikt:F(n), wikt:F(n), wikt:F(n), wikt:n(n, wikt:F(n), wikt:F(M), wikt:F(M), wikt:O(p), wikt:O(n, wikt:F(n), wikt:F(n), wikt:F(n), wikt:ddei, wikt:ddei: mathematical formulas. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 2 - Darbuka (disambiguation) - wikt:debuka, wikt:dumbelek: other names for the subject of the page, but in unknown languages. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 1 - Darik's Boot and Nuke - wikt:shredos: appears to be the name of a software program. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 5 - Dark Benediction - wikt:dermies, wikt:dermies: an in-universe term. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 2 - Dark Carnival (novel) - wikt:wrinklie: an in-universe term. Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 2 - Darwinia (plant) - wikt:darwinias-plural of the subject of the page (and OK with lower case). Ira Leviton (talk) 01:00, 4 September 2020 (UTC)
- 1 - David Coulthard - wikt:trepassed: unclear meaning, tagged. Ira Leviton (talk) 15:13, 4 September 2020 (UTC)
- 1 - David Duchovny - wikt:chemistri: apparently the name of an advertising agency. Ira Leviton (talk) 15:13, 4 September 2020 (UTC)
- 3 - David Ross Locke - wikt:impendin, wikt:condishun, wikt:reesons: intentional misspellings in a title. Ira Leviton (talk) 15:13, 4 September 2020 (UTC)
- 1 - David Thesmar - wikt:organistic: not a typo. Ira Leviton (talk) 15:13, 4 September 2020 (UTC)
- 1 - Deadshot - wikt:nanoexplosives: an in-universe term. Ira Leviton (talk) 18:33, 4 September 2020 (UTC)
- 7 - Death Gate - wikt:tytans, wikt:tytans, wikt:tytans, wikt:tytans, wikt:tytans, wikt:tytans, wikt:tytans: an in-universe term. Ira Leviton (talk) 18:33, 4 September 2020 (UTC)
- 4 - Deb (file format) - wikt:use .ipk, wikt:conffiles, wikt:prerm: a software file suffix and software jargon. Ira Leviton (talk) 18:33, 4 September 2020 (UTC)
- 3 - Debromoaplysiatoxin - wikt:diolide: a type of chemical. Ira Leviton (talk) 18:33, 4 September 2020 (UTC)
- 5 - Deer - wikt:cervoids, wikt:rangiferines, wikt:hydropotines: all are OK. Ira Leviton (talk) 22:11, 4 September 2020 (UTC)
- 7 - Deer hay wind - wikt:elricks, wikt:elricks, wikt:wynding, wikt:elricks, wikt:elricks, wikt:wynding, wikt:elricks: probably Gaelic, but I'm not sure. Ira Leviton (talk) 22:11, 4 September 2020 (UTC)
- 5 - Delta update - wikt:bsdiff, wikt:deltarpms, wikt:bsdiff, wikt:bsdiff, wikt:bsdiff: software jargon. Ira Leviton (talk) 22:11, 4 September 2020 (UTC)
- 1 - Denial-of-service attack - wikt:monlist: some type of technology jargon. Ira Leviton (talk) 02:30, 5 September 2020 (UTC)
- 1 - Dentistry - wikt:geriodontics: a legit word. Ira Leviton (talk) 02:30, 5 September 2020 (UTC)
- 1 - Derbe - wikt:praefecture: not sure if this or prefecture is correct, the citation is not linked. Ira Leviton (talk) 03:40, 6 September 2020 (UTC)
- 2 - Derlin-1 - wikt:derlins, wikt:derlins: the name of a family of proteins. Ira Leviton (talk) 03:40, 6 September 2020 (UTC)
- 2 - Desizing - wikt:desized: seems legit - see the title of the page. Ira Leviton (talk) 03:40, 6 September 2020 (UTC)
- 2 - Detarium microcarpum - wikt:dattock, wikt:dattock: unclear local language. Ira Leviton (talk) 03:40, 6 September 2020 (UTC)
- 4 - Deterministic finite automaton - wikt:anbn: mathematical notation. Ira Leviton (talk) 03:40, 6 September 2020 (UTC)
- 1 - Deutscher Eisenbahn-Verein - wikt:rollbocks: a legit word. Ira Leviton (talk) 20:22, 2 September 2020 (UTC)
- 2 - Developable roller - wikt:hexacon, wikt:platonicons: legitimate words in topology. Ira Leviton (talk) 20:22, 2 September 2020 (UTC)
- 1 - Development of the cerebral cortex - wikt:nudF: the name of a gene. Ira Leviton (talk) 20:22, 2 September 2020 (UTC)
- 1 - Device file - wikt:devd: computer jargon. Ira Leviton (talk) 20:22, 2 September 2020 (UTC)
- 2 - Df (Unix) - wikt:statfs, wikt:statvfs: software jargon. Ira Leviton (talk) 20:22, 2 September 2020 (UTC)
- 1 - Diazinon - wikt:yl)pyrimidin: part of a chemical name. Ira Leviton (talk) 18:25, 8 September 2020 (UTC)
- 1 - Dickinson (TV series) - wikt:wiip: a production company. CateFromArcadia (talk) 15:50, 9 September 2020 (UTC)
- 1 - Dictyostelium - wikt:glorin: a biological term. CateFromArcadia (talk) 15:50, 9 September 2020 (UTC)
- 32 - Differential diagnosis - wikt:Pr(Presentation, wikt:Pr(Presentation, wikt:Pr(Presentation, wikt:Pr(Presentation, wikt:Pr(Presentation, wikt:Pr(Presentation, wikt:Pr(Condition, wikt:Pr(Condition, wikt:Pr(Condition, wikt:P(No, wikt:P(PH, wikt:Odds(PostBTPH), wikt:Odds(PreBTPH, wikt:LH(BT), wikt:Odds(PostBTPH), wikt:Odds(PostH, wikt:P(PostH, wikt:P(PostH, wikt:ascular, wikt:nflammatory, wikt:nfectious, wikt:eoplastic, wikt:egenerative, wikt:eficiency, wikt:diopathic, wikt:ntoxication, wikt:utoimmune, wikt:llergic, wikt:raumatic, wikt:ndocrine, wikt:nvironmental, wikt:etabolic: mathematical formulas and mnemonics. Ira Leviton (talk) 02:27, 10 September 2020 (UTC)
- 3 - Differential equation - wikt:desolve(y, wikt:desolve, wikt:desolve: software programming jargon. Ira Leviton (talk) 02:27, 10 September 2020 (UTC)
- 2 - Diffuse large B-cell lymphoma - wikt:DLBCL,NOS, wikt:DLBCL,NOS: biological terms; I'm not sure whether there should be a space here or not. CateFromArcadia (talk) 15:50, 9 September 2020 (UTC)
- 3 - Diffusion MRI - wikt:ln(S, wikt:fxy: mathematical notations. Ira Leviton (talk) 02:27, 10 September 2020 (UTC)
- 20 - Digermyne - wikt:N(Si, bis[bis, wikt:G(d), wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:germirane, wikt:digermynes, wikt:digermynes, wikt:digermynes, wikt:digermynes
- 3 - Digital cross connect system - wikt:transmuxed, wikt:transmuxed, wikt:transmuxed: a legit word. Ira Leviton (talk) 01:10, 10 September 2020 (UTC)
- 9 - Diiminopyridine - wikt:M(DIP), wikt:M(DIP), wikt:M(DIP), wikt:Fe(DIP), wikt:Fe(DIP), wikt:Fe(DIP), wikt:Fe(DIP), wikt:M(DIP): chemical formulas. Ira Leviton (talk) 01:10, 10 September 2020 (UTC)
- 2 - Diligence (Scots law) - wikt:furthcoming, wikt:furthcoming: a legal term in British English and Scots law. Ira Leviton (talk) 14:39, 11 September 2020 (UTC)
- 1 - Dilophosaurus - wikt:chonoses: an arcane term in dinosaur anatomy (plural).
- 6 - Dimensional analysis - wikt:d(dx, T[F], T[C], T[C], T[F], wikt:log(a
- 5 - Dinocyst - wikt:chorate, wikt:periphragm, wikt:periphragm, wikt:periphragm, wikt:periphragm: biological terms. CateFromArcadia (talk) 20:41, 10 September 2020 (UTC)
- 1 - Dinosaucers - wikt:defossilize = defossilize does appear in places.
- 1 - Dioon purpusii - (probably OK: wikt:sarcotestas): a term for a seed coat (plural). Ira Leviton (talk) 14:39, 11 September 2020 (UTC)
- 1 - Dioxins and dioxin-like compounds - wikt:benzo(a): a chemical name. Ira Leviton (talk) 14:39, 11 September 2020 (UTC)
- 2 - Dioxolane - wikt:sporol, wikt:sporol: a chemical compound. CateFromArcadia (talk) 18:40, 10 September 2020 (UTC)
- 3 - Dioxygenase - wikt:HXH(X), wikt:PXG(X), wikt:iron(V): chemistry terms. Ira Leviton (talk) 14:39, 11 September 2020 (UTC)
- 2 - Diphosphenes - bis[tris, wikt:diperoxides: part of a chemical formula, and the name of a chemical class. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 2 - Diphthong - wikt:yodization: a linguistics term. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx beroni - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx fagniezi - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx hirpinus - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx italicus - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx limbarae - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx nexus - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx sardous - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Dipljapyx silanus - wikt:entroph: a type of insect. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 3 - Direction-preserving function - wikt:ch(X), wikt:ch(X), wikt:ch(X): parts of mathematical formulas. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 5 - Discourse grammar - wikt:theticals, wikt:theticals, wikt:theticals, wikt:theticals, wikt:modalizing: linguistic or grammar terminology. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 1 - Discovery and development of non-nucleoside reverse-transcriptase inhibitors - wikt:phenylthio)thymine: part of a chemical name. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 7 - Discovery and development of tubulin inhibitors - wikt:Ala(P), wikt:Ala(P), wikt:Vla(P): parts of chemical names. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 2 - Discrete category - wikt:homC(X, wikt:homC: parts of mathematical notations. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 4 - Discrete-time Markov chain - wikt:Pr(Xn, wikt:Pr(X, wikt:Pr(Xn, wikt:pji: parts of mathematical notations. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 11 - Discworld (world) - wikt:thaumometer, wikt:thaumometer, wikt:thaums, wikt:fingles, wikt:fingles, wikt:knurdness, wikt:knurdness, wikt:rhinu, wikt:morporks, wikt:unggue, wikt:quirma: all in-universe terminology. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 1 - Disemvoweling - wikt:brwn: written deliberately, the article is about removing vowels. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 1 - Dissocarpus paradoxus - wikt:solonized: A legit word. Ira Leviton (talk) 02:06, 9 September 2020 (UTC)
- 1 - Diver training - wikt:unkitting: a Britishism, for removing a uniform or gear (or a kit). Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 3 - Divide-and-conquer algorithm - wikt:O(n, wikt:logpn: parts of mathematical formulas. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Division of the field - wikt:tiercing: an obsolete word meaning "dividing into three parts. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Divnogorye - wikt:petrophytic: a biological term. CateFromArcadia (talk) 08:06, 11 September 2020 (UTC)
- 2 - Dizmo AG - wikt:dizmos, wikt:dizmos: a product created by this company (plural). Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 1 - Djinang people - showing two spellings for a name. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 3 - Dmitri Nusinow - wikt:arrhythmo, wikt:phyB, wikt:phyB: parts of gene names. Ira Leviton (talk) 17:34, 11 September 2020 (UTC)
- 5 - Dog coat genetics - wikt:sabling, wikt:sabling, wikt:urajiro, wikt:urajiro, wikt:urajiro: arcane but legit words. Ira Leviton (talk) 18:10, 10 September 2020 (UTC)
- 1 - Dom language - wikt:take.INF: I'm not sure what's going on here, but it's deliberate and to show grammar and syntax in this language. Ira Leviton (talk) 22:24, 7 September 2020 (UTC)
- 1 - Dominica - wikt:tanias: a vegetable (plural). Ira Leviton (talk) 22:24, 7 September 2020 (UTC)
- 2 - Dominican Spanish - wikt:jaguai, wikt:jasguar: misspelled deliberately, to show pronunciations. Ira Leviton (talk) 22:24, 7 September 2020 (UTC)
- 6 - Donaldism - wikt:DDF(R), wikt:DDF(R), wikt:NAFS(K), wikt:NAFS(K), wikt:appet, wikt:appet: parts of titles of fan magazines. Ira Leviton (talk) 01:25, 7 September 2020 (UTC)
- 1 - Dopamine antagonist - (probably OK: wikt:prefontal): corrected to prefrontal. Ira Leviton (talk) 01:25, 7 September 2020 (UTC)
- 5 - Dopping cement - wikt:dopsticks, wikt:dopstick, wikt:dopstick, wikt:dopstick, wikt:dopstick: all OK. Ira Leviton (talk) 01:25, 7 September 2020 (UTC)
- 1 - Dorylaimida - wikt:alaims: a group of worms (plural). Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 1 - Dorylus laevigatus - wikt:unpupated: a legit word. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 1 - Doublecortin - wikt:doublin: a genetics or molecular biology term. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 11 - Doubletime (gene) - wikt:dbts, wikt:dbts, wikt:dbtS, wikt:dbtS, wikt:dbtS, wikt:dbtS, wikt:dbtS, wikt:dbts, wikt:dbtS: all are legit. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 6 - Doughnut - wikt:koeks, wikt:koeks, wikt:tangentic, wikt:tangentic: a regional pronunciation and a legit term (I think). Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 1 - Downstream-peptide motif - wikt:gifB: the name of a gene. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 1 - Dr. Horacio E. Oduber Hospital - (probably OK: wikt:cathlab): slang term, I corrected to catheterization laboratory. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 2 - Dracontium spruceanum - wikt:jergon, wikt:jergon: a local name for this plant. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 2 - Dragon Ball Z Complete Song Collection 2: Incredible Mightiest vs. Mightiest - E[nergy], wikt:nergy: clarifying that E is for Energy. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 1 - Dragon's Kin - wikt:whers: an in-universe term. Ira Leviton (talk) 21:35, 7 September 2020 (UTC)
- 5 - Dreamshell - wikt:sdiso, wikt:fatfs, wikt:sdiso, wikt:fatfs, wikt:luac: software jargon for this video game.
- 1 - Drumline - wikt:gocks: a type of drum (plural). Ira Leviton (talk) 18:55, 6 September 2020 (UTC)
- 1 - Dry low emission - wikt:premixers: a legit word (plural). Ira Leviton (talk) 18:55, 6 September 2020 (UTC)
- 3 - Dry milling and fractionation of grain - wikt:degermination, wikt:degermination, wikt:degermination: a legit word. Ira Leviton (talk) 18:55, 6 September 2020 (UTC)
- 13 - Duffy antigen system - wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a, wikt:Fy(a), wikt:Fy(b), wikt:Fy(a, wikt:Fy(a, wikt:Fy(a: biology/medical jargon. Ira Leviton (talk) 16:08, 6 September 2020 (UTC)
- 3 - Duratrans - wikt:translites, wikt:translites, wikt:translites: another word for duratrans, the subject of the page. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Durham Light Infantry - wikt:nuggers: a type of boat (plural). Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Dwarfism in chickens - wikt:thyrogenous: a medical term. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 5 - Dwile flonking - wikt:flonks, wikt:girters, wikt:flonks, wikt:girters, wikt:snurd: terms in the game of dwile flonking. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Dynactin - wikt:dynamitin: the name of a protein. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Dynamic nuclear polarization - wikt:dipolarly: seems a legit descriptive word. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Dysart, Fife - wikt:ogile: unclear, the references for this are not online. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 3 - Déborah Heissler - wikt:Ecri(peind), wikt:effet(s), wikt:peind: parts of poem titles. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
- 1 - Dīghajāṇu Sutta - wikt:kammic: seems legit. Ira Leviton (talk) 20:17, 7 September 2020 (UTC)
TS+DOT+
[edit]- 1 - DJ Puzzle - wikt:iPro.DJSampler: a product name. Ira Leviton (talk) 03:45, 2 September 2020 (UTC)
- 3 - DNA-encoded chemical library - wikt:m)r, wikt:amplificability: part of a formula, and molecular biology jargon. Ira Leviton (talk) 03:45, 2 September 2020 (UTC)
- 1 - Dan Atar - wikt:i.Br: German style, without a space after the period. Ira Leviton (talk) 02:17, 2 September 2020 (UTC)
- 4 - Daniel Cudmore (businessman) - wikt:J(ames), wikt:J(ames), wikt:T(homas): showing full names. Ira Leviton (talk) 02:14, 2 September 2020 (UTC)
- 6 - Dative construction - wikt:me.DAT, wikt:go.INFIN: abbreviations in linguistics. Ira Leviton (talk) 02:14, 2 September 2020 (UTC)
- 4 - Deep chlorophyll maximum - wikt:pyrrophytes, wikt:pyrrophytes, wikt:nuricline: chemical names.
- 3 - Delta Field (Niger Delta) - wikt:depobelts, wikt:depobelts, wikt:depobelts: a geologic term. Ira Leviton (talk) 20:00, 1 September 2020 (UTC)
- 3 - Dental composite - wikt:polyceram, wikt:flowables: a chemical name and a plural chemical term. Ira Leviton (talk) 20:00, 1 September 2020 (UTC)
- 2 - Diaporthe helianthi - wikt:telomorphic: a botany or cellular term. Ira Leviton (talk) 03:18, 1 September 2020 (UTC)
- 2 - Discovery and development of ACE inhibitors - wikt:Asp(L), wikt:L)Ala: parts of chemical notations. Ira Leviton (talk) 15:14, 31 August 2020 (UTC)
- 2 - Discovery and development of direct Xa inhibitors - wikt:cyclisizes, wikt:arylized: chemistry jargon. Ira Leviton (talk) 15:14, 31 August 2020 (UTC)
- 1 - Discovery and development of integrase inhibitors - wikt:yl)phenyl: part of a chemical name. Ira Leviton (talk) 15:14, 31 August 2020 (UTC)
- 3 - Discrete cosine transform - wikt:O(N, wikt:O(N, wikt:O(N: Mathematical notations. Ira Leviton (talk) 15:14, 31 August 2020 (UTC)
- 3 - Don Tallon with the Australian cricket team in England in 1948 - wikt:three.N, wikt:matches.N, wikt:summer.N: the Ns are parts of footnotes written as superscripts. Ira Leviton (talk) 21:02, 30 August 2020 (UTC)
- 4 - Double-ended priority queue - wikt:put(x), wikt:remove(node, wikt:remove(node, wikt:O(log: mathematical jargon. Ira Leviton (talk) 21:02, 30 August 2020 (UTC)
- 1 - Doug Ring with the Australian cricket team in England in 1948 - wikt:positions.N: the N is part of a footnote written as a superscript. Ira Leviton (talk) 21:50, 30 August 2020 (UTC)
- 1 - Dutch Shepherd - wikt:mondioring: a dog sport, done at dog shows. Ira Leviton (talk) 04:30, 31 August 2020 (UTC)
TS+COMMA+
[edit]- 3 - DG/L - wikt:str,length, wikt:setcurrent(str, wikt:length(str): software jargon. Ira Leviton (talk) 02:32, 29 August 2020 (UTC)
- 2 - DNA transposon - wikt:V(D), wikt:V(D): part of a molecular biology abbreviation. Ira Leviton (talk) 02:32, 29 August 2020 (UTC)
- 42 - Damerau–Levenshtein distance - wikt:CA,ABC, wikt:CA,ABC, wikt:CA,AC, wikt:AC,ABC, wikt:CA,ABC, wikt:LD(CA, wikt:OSA(CA, wikt:OSA(CA, wikt:OSA(AC, wikt:OSA(CA, wikt:length(a), wikt:length(b), wikt:length(a), wikt:length(b), wikt:length(a), wikt:length(b), wikt:length(a), wikt:length(b), wikt:length(a), a[i], b[j], d[i, wikt:minimum(d, d[i, d[i, wikt:minimum(d, d[length, wikt:length(b), d[i, wikt:minimum(d, wikt:length(a), wikt:length(b), da[i], d[i, wikt:length(b), da[b, a[i], b[j], d[i, d[k, d[length, wikt:length(b): mathematical notations and formulas. Ira Leviton (talk) 02:32, 29 August 2020 (UTC)
- 1 - Dead Cities, Red Seas & Lost Ghosts - wikt:DeadCities,RedSeas: a style, without a space after the comma. Ira Leviton (talk) 19:16, 29 August 2020 (UTC)
- 2 - Dean of Christ Church Cathedral, Dublin - wikt:W(illiam, wikt:War(r): indication of a full name and an alternative spelling. Ira Leviton (talk) 19:16, 29 August 2020 (UTC)
- 3 - Decaprenylphospho-beta-D-ribofuranose 2-oxidase - wikt:trans,octacis, wikt:trans,octacis, wikt:trans,octacis: part of chemical names. Ira Leviton (talk) 19:16, 29 August 2020 (UTC)
- 20 - Deligne–Lusztig theory - wikt:λx,λy, wikt:X(w), wikt:T(w), wikt:vwF(v), wikt:N(T), wikt:F(u), wikt:T(F), wikt:X(T), wikt:T(w), wikt:X(w), wikt:W(T, wikt:W(T, wikt:G(u), wikt:Hi(X, wikt:G(k), wikt:s(s, wikt:s(s, wikt:T(w), wikt:X(w), wikt:X(w): parts of mathematical formulas. Ira Leviton (talk) 19:16, 29 August 2020 (UTC)
- 1 - Demonic possession - wikt:voice,34: 34 is used as a superscript to indicate a Bible verse. Ira Leviton (talk) 19:16, 29 August 2020 (UTC)
- 4 - Dendrocoelum - wikt:adenodactyl: an organ of this animal. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 3 - Dental laser - wikt:Er,Cr, wikt:Er,Cr, wikt:Er,Cr: an abbreviation for a type of dental laser. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 4 - Departure function - wikt:v1,T1, wikt:v2,T2, wikt:h(v, wikt:h(v: parts of mathematical formulas. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 3 - Depth of noncommutative subrings - wikt:RH,RG, wikt:sub)algebra, wikt:d(RH: parts of mathematical formulas. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 3 - Despoina - wikt:jo,po, wikt:m(ha), wikt:dem(ha): parts of mathematical formulas. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 10 - Determinacy - wikt:a1,a3, wikt:y0,y1, wikt:game(s), p[T], wikt:max(y, wikt:ylen(s), wikt:len(s), wikt:G(A, wikt:G(A, wikt:A ,B: parts of mathematical formulas. Ira Leviton (talk) 20:44, 29 August 2020 (UTC)
- 5 - Di-trans,poly-cis-decaprenylcistransferase - wikt:trans,poly, wikt:trans,poly, wikt:trans,poly, wikt:trans,poly, wikt:trans,poly: parts of chemical names. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 22 - Dialog manager - wikt:Speaker,Hearer, wikt:Speaker,Predicate, wikt:Speaker,Inform, wikt:Speaker,Hearer, wikt:Hearer,Predicate, wikt:Hearer,Wants, wikt:Speaker,Knows, wikt:Hearer,Predicate, wikt:in(SHARED, wikt:fst(SHARED, wikt:answer(Q, wikt:pop(SHARED, wikt:reduce(Q, wikt:add(SHARED, wikt:Inform(Speaker, wikt:Knows(Speaker, wikt:Wants(Speaker, wikt:Inform(Speaker, wikt:Knows(Hearer, wikt:Believes(Hearer, wikt:Wants(Speaker, wikt:Knows(Hearer: this article is written in jargon and without context, I can't tell if these terms are correct without spaces prior to the commas or opening parentheses. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 6 - Dialogical logic - A[x], A[x], xA[x], A[x, xA[x], A[x: parts of mathematical formulas. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 2 - Diamine N-acetyltransferase - wikt:alpha,omega, wikt:alpha,omega: part of a chemical name. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 1 - Diaminopimelate dehydrogenase - wikt:alpha,epsilon: part of an enzyme name. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 2 - Dicarboxylic acid - wikt:c6,c9, wikt:isosebacic: parts of chemical formulas and names. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 2 - Diels–Alder reaction - wikt:cis,trans, wikt:dieneophile: parts of chemical names. Ira Leviton (talk) 01:13, 30 August 2020 (UTC)
- 42 - Differential forms on a Riemann surface - wikt:c1,d1, wikt:a1,b1, wikt:eix,eiy, wikt:du,dh, wikt:f(x, wikt:h(y), wikt:f(x, wikt:f(x, wikt:i(t), wikt:f(z), wikt:Dx)p, wikt:Dy)q, wikt:C(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:k(T, wikt:Hk(T, wikt:k(T, wikt:Hk(T, wikt:Hk(T, wikt:Hk(T, wikt:Hj(T, wikt:Hk(T, wikt:Hj(T, wikt:Hk(T, wikt:k(T, wikt:k(T, wikt:k(T, wikt:k(T, wikt:k(T, wikt:Cc(X), wikt:Cc(X), wikt:d(da), wikt:u(z), wikt:D(z), wikt:d(z: parts of mathematical formulas. Ira Leviton (talk) 02:54, 30 August 2020 (UTC)
- 1 - Differential group delay - wikt:ET,total: mathematical notation. Ira Leviton (talk) 02:54, 30 August 2020 (UTC)
- 2 - Dimensionless momentum-depth relationship in open-channel flow - wikt:uMmin, wikt:uMmin: mathematical notations. Ira Leviton (talk) 02:54, 30 August 2020 (UTC)
- 4 - Dinesh Subasinghe - wikt:T(H), wikt:T(H), wikt:T(H), wikt:kingiri: part of a title of an album, and a musical instrument. Ira Leviton (talk) 02:54, 30 August 2020 (UTC)
- 2 - Dir (princely state) - [wikt:D(h)]], wikt:Jando(o): showing alternative spellings. Ira Leviton (talk) 02:54, 30 August 2020 (UTC)
- 4 - Discovery and development of cyclooxygenase 2 inhibitors - wikt:thromboxane(s), wikt:superoxide(O, wikt:cis-3,4-dihydrorofecoxib, wikt:trans-3,4-dihydrorofecoxib: parts of chemical names. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 9 - Disjoint-set data structure - wikt:v1,v2, wikt:Find(x), wikt:Union(x, wikt:O(log, wikt:O(log, wikt:O(m, wikt:O(m), wikt:O(mlog, wikt:O(m: parts of mathematical formulas. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 1 - Dispersin B - wikt:PNAG,PS: molecular biolgy jargon. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 1 - Display contrast - wikt:CR,CM: mathematical notation. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 6 - Distance from a point to a line - wikt:x0,y0, wikt:x0,y0, wikt:x1,y1, wikt:x2,y2, wikt:x0,y0, wikt:x0,y0: mathematical notations. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 1 - Divinylcyclopropane-cycloheptadiene rearrangement - wikt:cis,trans: chemistry terminology, correct with no space after the comma. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 2 - Docosanedioic acid - wikt:carboyoctyl)thiophene, wikt:docosa-10,12-diynedoic: parts of chemical formulas. Ira Leviton (talk) 17:28, 30 August 2020 (UTC)
- 2 - Dominance order - wikt:p1,p2, wikt:q1,q2: mathematical notations. Ira Leviton (talk) 19:00, 30 August 2020 (UTC)
- 6 - Douady–Earle extension - wikt:z1,z3, wikt:z2,z4, wikt:Hf(z), wikt:C(T), wikt:f(z), wikt:f(w): parts of mathematical formulas. Ira Leviton (talk) 19:00, 30 August 2020 (UTC)
- 10 - Double auction - wikt:sk,bk, wikt:bk,sk, wikt:sk,bk, wikt:bk,sk, wikt:buyers,num, wikt:max(sk, wikt:min(bk, wikt:max(sk, wikt:min(bk, wikt:min(num: mathematical notations. Ira Leviton (talk) 19:00, 30 August 2020 (UTC)
- 12 - Doubling-oriented Doche–Icart–Kohel curve - wikt:x1,y1, wikt:x2,y2, wikt:x3,y3, wikt:x1,y1, wikt:x3,y3, wikt:X1,Y1, wikt:X2,Y2, wikt:x3,y3, n]P, wikt:a)x, wikt:V(X, wikt:a(YY: mathematical notations. Ira Leviton (talk) 19:00, 30 August 2020 (UTC)
- 4 - Dowling geometry - wikt:Bk,αk, wikt:Qn(G), wikt:Qn(G), wikt:Qn(G): mathematical notations. Ira Leviton (talk) 19:00, 30 August 2020 (UTC)
- 5 - Dryden Wind Turbulence Model - wikt:ug,vg, wikt:pg,qg, wikt:G(s), wikt:y(t), wikt:y(t): mathematical notations. Ira Leviton (talk) 19:42, 30 August 2020 (UTC)
- 1 - Dual of BCH is an independent source - wikt:BCH2,log: mathematical notation. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
- 6 - Dualizing module - wikt:x2,y2, wikt:y2,xy, wikt:height(m), wikt:height(m), k[x, k[x: mathematical formulas or parts. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
- 2 - Duchy of Gascony - wikt:Aznar(i), wikt:Ximen(o): showing alternative name endings. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
- 2 - Duncan's new multiple range test - wikt:T3,T2, wikt:T5,T1: mathematical notations. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
- 3 - Dupin cyclide - wikt:x1,x2, wikt:x1,x2, wikt:x3,r2: mathematical notations. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
- 2 - Dvals - ama[r], wikt:hcawj: no code for Dval language. Ira Leviton (talk) 19:38, 28 August 2020 (UTC)
TS+EXTRA+
[edit]- 2 - DCF77 - wikt:identifier .DCFa, wikt:or .DCFp: software jargon. Ira Leviton (talk) 18:11, 27 August 2020 (UTC)
- 5 - DICT - wikt:a .index, wikt:a .dict, wikt:or .dict, wikt:a .dict, wikt:dictfmt: software jargon. Ira Leviton (talk) 18:11, 27 August 2020 (UTC)
- 2 - DV - wikt:are .dv, wikt:libdv: software jargon. Ira Leviton (talk) 18:11, 27 August 2020 (UTC)
- 3 - Debian configuration system - wikt:the .templates, wikt:the .config, wikt:while .postinst: software jargon. Ira Leviton (talk) 02:40, 27 August 2020 (UTC)
- 1 - Demon Internet - wikt:the .demon: part of a url. Ira Leviton (talk) 02:40, 27 August 2020 (UTC)
- 1 - Digest access authentication - wikt:the .htdigest: software jargon. Ira Leviton (talk) 20:06, 27 August 2020 (UTC)
- 1 - Digital Video Interactive - wikt:the .AVS: software file suffix. Ira Leviton (talk) 20:06, 27 August 2020 (UTC)
- 1 - Digital rights management - wikt:s .azw4: software jargon. Ira Leviton (talk) 20:06, 27 August 2020 (UTC)
- 1 - Domain generation algorithm - wikt:and .b: software jargon. Ira Leviton (talk) 20:49, 27 August 2020 (UTC)
- 9 - Domain hack - wikt:and .le, wikt:create .its: software instructions. Ira Leviton (talk) 20:49, 27 August 2020 (UTC)
- 2 - Dynamic cascading style sheets - wikt:A .dcss, wikt:included .dcss: software jargon. Ira Leviton (talk) 20:49, 27 August 2020 (UTC)
- 4 - Dál Fiatach - wikt:F)iatach, wikt:iatach: written deliberately as (F)iatach because of uncertainty about the first letter. Ira Leviton (talk) 20:49, 27 August 2020 (UTC)
HB+
[edit]- 1 - Distributed Proofreaders Canada - <i>: this one was done deliberately, to show html code. Ira Leviton (talk) 18:02, 28 August 2020 (UTC)
- 1 - Doctor Who (season 21) - </table>: I can't find this in the coding. Ira Leviton (talk) 18:02, 28 August 2020 (UTC)
- 1 - Doctor Who (season 4) - </table>: I can't find this in the coding. Ira Leviton (talk) 18:02, 28 August 2020 (UTC)
Case notes (D) from 2020-01-20 dump
[edit]TS+ DOT+
[edit]DX-Daj
[edit]- 1 - Damn Small Linux - wikt:in .uci: software jargon. Ira Leviton (talk) 15:40, 6 February 2020 (UTC)
- 1 - Damn Vulnerable Linux - wikt:Slackware .tgz: software jargon. Ira Leviton (talk) 15:40, 6 February 2020 (UTC)
- 2 - Dan Blocker - wikt:Colt .45, wikt:how's: gun name, inadvertent detection of "show's"".
- 3 - Daniel Koren - wikt:how's, wikt:it's, wikt:he's: inadvertent detection of "show's", words in titles of albums. Ira Leviton (talk) 02:55, 9 February 2020 (UTC)
- 1 - Daniel Rey - wikt:ell.Out: written deliberately as "$ell.Out."
- 1 - Danish UNIX User Group - wikt:the .dk: referring to the .dk internet address suffix.
- 4 - Darbuka Siva - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 01:48, 11 February 2020 (UTC)
- 2 - Darcy Burner - wikt:Microsoft .NET, wikt:on .NET: software jargon. Ira Leviton (talk) 01:48, 11 February 2020 (UTC)
- 1 - DarkOrbit - wikt:it's: inadvertent detection of "Orbit's". Ira Leviton (talk) 01:48, 11 February 2020 (UTC)
- 1 - Darlington F.C. - wikt:here's: inadvertent detection of "There's" in the title of a magazine. Ira Leviton (talk) 01:48, 11 February 2020 (UTC)
- 1 - Data Interchange Format - wikt:a .dif: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Data Moving Tool - wikt:Microsoft .NET: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 2 - Data analysis - wikt:A .NET: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Data codes for Switzerland - wikt:see .ch: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Data position measurement - wikt:the .mds: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Data structure - wikt:Microsoft .NET: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 2 - Data2map - wikt:format .ai, wikt:formats .ai: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Databank format - wikt:extension .db: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - Datafork TrueType - wikt:extension .dfont: software jargon. Ira Leviton (talk) 22:28, 11 February 2020 (UTC)
- 1 - David Gewirtz - wikt:Outlook .PST: software jargon. Ira Leviton (talk) 22:29, 12 February 2020 (UTC)
- 1 - David Peel (musician) - wikt:called .On: inadvertent detection because of intervening quotation marks. No typo. Ira Leviton (talk) 22:29, 12 February 2020 (UTC)
- 6 - David Rossi - wikt:A1 .45, wikt:how's: gun model, inadvertent detection of "show's". Ira Leviton (talk) 22:29, 12 February 2020 (UTC)
- 3 - DbDOS - wikt:a .BAT, wikt:a .EXE: software jargon.
- 1 - DeMarlo Hale - wikt:a .508: winning percentage. Ira Leviton (talk) 04:13, 16 February 2020 (UTC)
- 2 - Death toll of the Nanjing Massacre - wikt:he's: inadvertent detection of another word, probably "Smythe's". Ira Leviton (talk) 05:01, 16 February 2020 (UTC)
- 1 - Deathsmiles - wikt:as .wav: software jargon. Ira Leviton (talk) 04:48, 16 February 2020 (UTC)
- 8 - Deep Zoom - wikt:a .dzi, wikt:or .xml, wikt:a .dzc, wikt:or .xml, wikt:the .dzc, wikt:the .dzc, wikt:of .dzi: software jargon. Ira Leviton (talk) 20:36, 16 February 2020 (UTC)
- 3 - Deep web - wikt:the .onion, wikt:hidden .onion, wikt:the .onion: a software suffix. Ira Leviton (talk) 20:36, 16 February 2020 (UTC)
- 1 - DeepDotWeb - wikt:sister .onion: ditto. Ira Leviton (talk) 20:36, 16 February 2020 (UTC)
- 1 - Defaults (software) - wikt:a .plist: software jargon. Ira Leviton (talk) 20:36, 16 February 2020 (UTC)
- 1 - Degol Woyane - wikt:downloaded .GPX: software jargon. Ira Leviton (talk) 20:36, 16 February 2020 (UTC)
- 2 - Dehydrogenation - wikt:iron(III: chemistry notation. Ira Leviton (talk) 01:54, 17 February 2020 (UTC)
- 2 - Delaware Fightin' Blue Hens football - wikt:impressive .747, wikt:a .714: winning percentages. Ira Leviton (talk) 01:54, 17 February 2020 (UTC)
- 1 - Delphi Archaeological Museum - wikt:hermaic: seems like a legit word, in archaeology. Ira Leviton (talk) 02:26, 17 February 2020 (UTC)
- 9 - Demonoid - wikt:from .com, wikt:a .me, wikt:a .ph, wikt:previous .me, wikt:the .ph, wikt:the .com, wikt:the .me, wikt:and .ph, wikt:the .com: all are software jargon terms. Ira Leviton (talk) 03:37, 17 February 2020 (UTC)
- 2 - Denbigh, Cobbitty - wikt:corroborrees. Apparently a legit word (and plural). Ira Leviton (talk) 03:37, 17 February 2020 (UTC)
- 1 - Deployment descriptor - wikt:application .ear: software program suffix. Ira Leviton (talk) 18:56, 17 February 2020 (UTC)
- 7 - Derek Morgan (Criminal Minds) - (probably OK: wikt:retconed): corrected to retconned. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 2 - Derrick Shepard (defensive lineman) - wikt:a .500, wikt:Their .500: winning percentages. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 2 - Deshapran (community development block) - wikt:cent.Decadal, wikt:peasants.Following
- 3 - Design Web Format - wikt:a .dwf, wikt:to .zip, wikt:with .NET: software jargon. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 1 - Designbox - wikt:supports .NET: software jargon. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 7 - Desk accessory - wikt:DOS .EXE, wikt:with .ACC, wikt:than .APP, wikt:Each .ACC, wikt:the .ACC, wikt:more .ACC, wikt:usually .ACX: software jargon. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 7 - Desktop (word processor) - wikt:sequential .Q: software jargon. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 1 - DesktopX - wikt:as .desktop: software jargon. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 3 - Desulfobacteraceae - (probably OK: wikt:ɥm, wikt:ɥm, wikt:ɥm): Replaced with μ as instructed in the last bullet at the top of the page and according to MOS:UNITSYMBOLS. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 1 - Detroit (band) - wikt:eventually .38: part of a band name. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 1 - Detroit Tigers award winners and league leaders - wikt:and .461: slugging average. Ira Leviton (talk) 23:06, 17 February 2020 (UTC)
- 3 - DevPartner - wikt:and .NET, wikt:and .NET, wikt:both .NET: software jargon. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 3 - Devan Dubnyk - wikt:and .921, wikt:a .934, wikt:a .920: save percentages. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 4 - Developmental language disorder - wikt:you, wikt:you, wikt:you: in a quotation. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 2 - Device driver - wikt:Windows .sys, wikt:Linux .ko: software jargon. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 3 - Devil May Cry: The Animated Series - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 2 - Devils–Flyers rivalry - wikt:under .500: winning percentage. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 1 - Devin Vassell - wikt:a .419: shooting percentage. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 1 - Dewayne Dedmon - wikt:a .551: shooting percentage. Ira Leviton (talk) 02:23, 18 February 2020 (UTC)
- 1 - Dexter Kernich-Drew - wikt:a .433: shooting percentage. Ira Leviton (talk) 22:06, 18 February 2020 (UTC)
- 8 - Dhana yoga - wikt:trikonas, wikt:trikonas, wikt:drekkena, wikt:trikonas, wikt:papagrahas (probably OK: wikt:triksthana, wikt:trikonabhava, wikt:drekkenas): yoga terms. Probably not English, but I'm not sure of the language so I can't tag them properly. Ira Leviton (talk) 22:06, 18 February 2020 (UTC)
- 2 - Dialog Control Language - wikt:Studio .NET, wikt:the .NET: software jargon. Ira Leviton (talk) 18:34, 19 February 2020 (UTC)
- 1 - Diana Mitford - wikt:he's: inadvertent detection of part of another word. Ira Leviton (talk) 18:34, 19 February 2020 (UTC)
- 1 - Dicastery for Communication - (probably OK: wikt:dicastry): corrected to dicastery. Ira Leviton (talk) 18:34, 19 February 2020 (UTC)
- 1 - Dick Bertrand - wikt:than .638: winning percentage. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 9 - Dick Billings - wikt:a .305, wikt:high .992, wikt:a .254, wikt:to .179, wikt:a .227, wikt:of .281, wikt:a .984, wikt:a .966, wikt:a .906: baseball statistics. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 1 - Dick Davey - wikt:of .581: winning percentage. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 2 - Dick Drott - wikt:Colt .45s, wikt:Colt .45s: team name. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 1 - Dick Gould - wikt:a .840: winning percentage. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 25 - Dick Greco (baseball) - wikt:hit .300, wikt:hitting .332, wikt:a .626, wikt:hit .313, wikt:batted .333, wikt:a .552, wikt:hit .330, wikt:a .604, wikt:hit .361, wikt:a .644, wikt:batted .312, wikt:a .618, wikt:hitting .298, wikt:a .499, wikt:hit .258, wikt:and .403, wikt:hitting .305, wikt:a .615, wikt:hit .305, wikt:hit .356, wikt:a .685, wikt:hit .364, wikt:a .656, wikt:hitting .367, wikt:around .328: baseball statistics. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 1 - Dick Maloney (American football) - wikt:His .534: winning percentage.
- 2 - Dick Ruthven - wikt:a .500: winning percentage. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 5 - Dick Siebert - wikt:a .282, wikt:was .332, wikt:was .379, wikt:a .990, wikt:a .676: baseball statistics. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 1 - Dick Stigman - wikt:a .500: winning percentage. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 8 - Dick Williams - wikt:of .260, wikt:Colt .45s, wikt:low .159, wikt:than .500, wikt:below .500, wikt:below .500, wikt:reached .500: baseball statistics, team name. Ira Leviton (talk) 21:13, 19 February 2020 (UTC)
- 2 - Diet-induced obesity model - (probably OK: wikt:lipoprotien, wikt:signallingpathways): corrected to lipoprotein and signalling pathways. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 1 - Difflugia - wikt:biogeonic: a legit word. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 6 - Digistar - wikt:and .sf, wikt:while .sf, wikt:Both .vl, wikt:and .sf, wikt:and .sfa, wikt:format .afa: software jargon. Ira Leviton (talk)
- 1 - Digital Equipment Corporation - wikt:ubiquitous .com: the famous internet domain suffix. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 4 - Digital Item - wikt:extension .m21, wikt:or .mp21: software jargon. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 2 - Digital tachograph - wikt:VO(EWG, wikt:a .ddd: software jargon. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 3 - Digital waveguide synthesis - wikt:using .VxD, wikt:not .WDM, wikt:a .VxD: software jargon. Ira Leviton (talk) 22:48, 19 February 2020 (UTC)
- 1 - Dino Esposito - wikt:several .NET: software jargon. Ira Leviton (talk) 22:14, 20 February 2020 (UTC)
- 7 - Dion James - wikt:batted .295, wikt:hit .312, wikt:hitting .332, wikt:a .288, wikt:a .364, wikt:and .392, wikt:a .987: baseball statistics. Ira Leviton (talk) 22:14, 20 February 2020 (UTC)
- 1 - Dipjan English High school - (probably OK: wikt:chamlagain): capitalized; it's a surname. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 3 - Direct Access Archive - wikt:the .daa, wikt:the .iso: software suffixes. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 3 - Direct inward dial - wikt:as .tif, wikt:or .pdf: software suffixes. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 2 - DirectShow - wikt:Microsoft .NET, wikt:how's: software jargon and an inadvertent detection of "show's." Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 2 - DirectSkin - wikt:the .NET, wikt:creating .NET: software jargon. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 5 - DirectX - wikt:Microsoft .NET, wikt:within .NET, wikt:the .NET, wikt:the .NET, wikt:for .NET: software jargon. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 2 - Dirt (TV series) - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 2 - Dirt Track Racing: Sprint Cars - wikt:the .DE2: software file suffix. Ira Leviton (talk) 22:43, 20 February 2020 (UTC)
- 1 - Disc2Phone - wikt:and .NET: software jargon. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 1 - DiscJuggler - wikt:a .cdi: software file suffix. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 2 - Disciples III: Renaissance - wikt:by .dat, wikt:uses .dat: software file suffix. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 3 - Disembowelment (band) - wikt:d.USK, wikt:d.USK, wikt:d.USK: the name of a band. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 1 - Disk Utility - wikt:to .dmg: software file suffix. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 7 - DiskImageMounter - wikt:open .img, wikt:and .dart, wikt:dmgpart: software jargon. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 13 - Display Data Channel - wikt:monitor .INF, wikt:I²C, wikt:I²C, wikt:I²C, wikt:I²C, wikt:I²C, wikt:I²C, wikt:I²C-based, wikt:I²C, wikt:I²C, wikt:I²C, wikt:I²C: software file suffix and technology jargon. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 1 - Distributed denial-of-service attacks on root nameservers - wikt:the .com: Correctly using the .com suffix. Ira Leviton (talk) 02:17, 21 February 2020 (UTC)
- 8 - Divergence-from-randomness model - wikt:obs,elite, wikt:poisson,all, wikt:elite(Kt, wikt:lambda(Kt, wikt:avgtf: math symbols and jargon. Ira Leviton (talk) 17:20, 21 February 2020 (UTC)
- 1 - Dixie Beehives (2005–11) - wikt:under .500: winning percentage. Ira Leviton (talk) 17:20, 21 February 2020 (UTC)
- 5 - Dmitry Burkov - wikt:Russian .RU, wikt:and .РФ, wikt:TLD .RU, wikt:domains .RU, wikt:and .РФ: Internet domain suffixes. Ira Leviton (talk) 17:20, 21 February 2020 (UTC)
- 1 - DnAnalytics - wikt:for .NET: software jargon. Ira Leviton (talk) 17:20, 21 February 2020 (UTC)
- 1 - Docsity - wikt:including .doc file extension name/software jargon Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 3 - Docstoc - wikt:as .docstoc, wikt:including .doc, wikt:and .ppt 1 = part of company name; 2, 3 = file extension names Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 1 - DocuWare - wikt:on .NET software jargon Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 1 - Document! X - wikt:other .NET software jargon Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 2 - Dodge Neon SRT-4 - wikt:dynoed seems to be a car industry term. Not sure if it should be added to wiktionary or not Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 5 - Dodiya - (probably OK: wikt:gautra, wikt:deepang, wikt:dodiyas) unsure of language or if there is better spelling available. Deepang capitalized because it's a proper name Whisperjanes (talk) 02:45, 20 February 2020 (UTC)
- 3 - Dolf Luque - wikt:a .227, wikt:a .355, wikt:with .599: baseball statistics. Ira Leviton (talk) 22:42, 22 February 2020 (UTC)
- 2 - Dolores Wilson (baseball) - wikt:of .217, wikt:a .864: baseball statistics. Ira Leviton (talk) 22:42, 22 February 2020 (UTC)
- 2 - Dolphin Cove (SeaWorld) - wikt:it's: inadvertent detection of "exhibit's". Ira Leviton (talk) 22:42, 22 February 2020 (UTC)
- 4 - Dolphins–Jets rivalry - wikt:above .500: winning percentage. Ira Leviton (talk) 22:42, 22 February 2020 (UTC)
- 7 - Domain name registrar - wikt:plus .us, wikt:included .com, wikt:and .us: domain suffixes. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 3 - Domain name registry - wikt:the .com, wikt:are .us, wikt:and .uk: domain suffixes. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 5 - Domain privacy - wikt:with .ca, wikt:of .us, wikt:and .ch, wikt:for .ch, wikt:and .li: domain suffixes. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 7 - Domain registration - wikt:plus .us: domain suffix. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 9 - Domainz - wikt:original .nz, wikt:the .nz, wikt:issued .nz, wikt:the .nz, wikt:the .nz, wikt:the .nz, wikt:the .nz, wikt:the .nz, wikt:the .nz: domain suffixes. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 1 - Domingo Germán - wikt:at .818: winning percentage. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 4 - Dominik Hašek - wikt:at .940, wikt:a .930, wikt:and .937, wikt:it's: save percentage, inadvertent detecton of "Detroit's". Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 3 - Don "Red" Barry - wikt:Colt .45, wikt:here's: team name, part of a movie title. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 4 - Don Arlich - wikt:Colt .45s, wikt:Colt .45s, wikt:Colt .45s, wikt:Colt .45s: team name. Ira Leviton (talk) 21:47, 21 February 2020 (UTC)
- 2 - Don Bradey - wikt:Colt .45s, wikt:Colt .45s: baseball team name. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 1 - Don Cahoon - wikt:around .500: winning percentage. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 1 - Don Chastain - wikt:Colt .45: the name of a TV series. 04:01, 22 February 2020 (UTC)
- 1 - Don Corbett - wikt:s .729: winning percentage following a possessive case. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 4 - Don Ferrarese - wikt:was .156, wikt:a .036, wikt:a .952, wikt:Colt .45: baseball statistics, team name. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 1 - Don Haggerty - wikt:Colt .45: gun name. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 2 - Don Heffner - wikt:batted .241, wikt:the .500: baseball statistics. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 12 - Don Hoak - wikt:batted .215, wikt:to .293, wikt:over .400, wikt:batted .261, wikt:batted .282, wikt:high .298, wikt:to .241, wikt:batted .231, wikt:a .265, wikt:and .396, wikt:a .959, wikt:batted .231: baseball statistics. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 6 - Don Hurst - wikt:batted .339, wikt:batted .199, wikt:a .298, wikt:a .375, wikt:and .478, wikt:a .987: baseball statistics. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 10 - Don Kessinger - wikt:Chicago(land, wikt:a .201, wikt:a .304, wikt:high .274, wikt:a .273, wikt:a .266, wikt:a .320, wikt:a .252, wikt:of .314, wikt:a .965: baseball statistics. Ira Leviton (talk) 04:01, 22 February 2020 (UTC)
- 27 - Don Mattingly - wikt:batted .463, wikt:bat .500, wikt:his .349, wikt:than .340, wikt:batted .358, wikt:and .316, wikt:hitting .325, wikt:hit .283, wikt:of .339, wikt:by .002, wikt:a .343, wikt:a .340, wikt:batted .324, wikt:batted .354, wikt:a .573, wikt:batted .352, wikt:a .327, wikt:a .311, wikt:to .303, wikt:a .256, wikt:averaged .290, wikt:a .304, wikt:over .300, wikt:batted .417, wikt:of .551, wikt:a .307, wikt:a .358: baseball statistics. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 3 - Don Mossi - wikt:below .500, wikt:below .500, wikt:of .990: baseball statistics. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 4 - Don Mueller - wikt:over .300, wikt:hit .389, wikt:of .296, wikt:of .712: baseball statistics. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Nachbaur - wikt:a .592: winning percentage. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 2 - Don Nottebart - wikt:Colt .45s, wikt:Colt .45s; team name. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Osborn - wikt:a .626winning percentage. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Peden - wikt:of .711: winning percentage. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Schwall - wikt:under .500: winning percentage. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Syme - wikt:the .NET: software jargon. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don Wilson (baseball) - wikt:finished .500: winning percentage. Ira Leviton (talk) 04:21, 22 February 2020 (UTC)
- 1 - Don't Look at Me (Desperate Housewives) - wikt:how's: inadvertent detection of "show's".
- 1 - Donald Russell (American football) - wikt:of .661: winning percentage. Ira Leviton (talk) 02:18, 23 February 2020 (UTC)
- 1 - Donatas Zavackas - wikt:His .807
- 1 - Donnie Steele - wikt:album .5: part of an album name.
- 2 - Doorstep (company) - wikt:the .no, wikt:of .com: software domain suffixes. Ira Leviton (talk) 03:01, 23 February 2020 (UTC)
- 1 - Dorota Nvotová - wikt:newspaper .týždeň: the name of a Czech newspaper. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
` 1 - Dorsal nexus (probably OK: wikt:parahipocampal): corrected to parahippocampal. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - Dot-S - wikt:as .S: showing a style. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - Dot. - wikt:the .com: correctly written. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 15 - DotCooperation - wikt:namespace .coop, wikt:the .coop, wikt:the .coop, wikt:The .coop, wikt:The .coop, wikt:the .coop, wikt:the .coop, wikt:the .coop, wikt:provides .coop, wikt:The .coop, wikt:all .coop, wikt:the .coop, wikt:the .coop, wikt:the .coop, wikt:Marque .coop: all software jargon. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 19 - DotGNU - wikt:s .NET, wikt:Basic .NET, wikt:the .NET, wikt:Portable .NET, wikt:any .NET, wikt:Like .NET, wikt:Portable .NET, wikt:Portable .NET, wikt:the .NET, wikt:the .NET, wikt:released .NET, wikt:the .NET, wikt:the .NET, wikt:official .NET, wikt:on .NET, wikt:regarding .NET (probably OK: wikt:libJIT, wikt:libJIT, wikt:libJIT): all software jargon. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - DotGears - wikt:as .GEARS: deliberately done to show stylization. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 2 - Dotfuscator - wikt:on .NET, wikt:the .NET: software jargon. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - Dotsoul - wikt:paste .rwx: software suffix. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - Dotted and dotless I - wikt:The .NET: software jargon. Ira Leviton (talk) 16:10, 23 February 2020 (UTC)
- 1 - Dr. Ben/Nick - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 01:09, 24 February 2020 (UTC)
- 1 - Drain - wikt:the .hack: software jargon.
- 1 - Drawing Express - wikt:a .EXP: software file extension suffix. Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 2 - Drawn File - wikt:is .drawn, wikt:a .drw: software file extension suffixes. Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 1 - Dream Market - wikt:an .onion: a software suffix. Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 1 - Drillia lignaria - (probably OK: wikt:whor): corrected to whorl. Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 2 - Drive Image (software) - wikt:was .gho, wikt:is .v2i: software jargon. Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 2 - Drosophila suzukii - wikt:it's: inadvertent detection of "fruit's". Ira Leviton (talk) 20:39, 24 February 2020 (UTC)
- 1 - Drum and lyre corps - wikt:cymbals .Sometimes
- 1 - Duma Ndlovu - wikt:how's: inadvertent detection of "show's".
- 3 - Duncan MacGregor Crerar - wikt:dowerets: in poetry. Ira Leviton (talk)
- 1 - Dundas Data Visualization - wikt:and .NET: software suffix. Ira Leviton (talk) 18:35, 25 February 2020 (UTC)
- 1 - Dungeon Siege II - wikt:the .ini: software file suffix. Ira Leviton (talk) 18:35, 25 February 2020 (UTC)
- 2 - Duplicati - wikt:either .NET: software suffix. Ira Leviton (talk) 18:35, 25 February 2020 (UTC)
- 2 - Duplone - wikt:duplones: plural of the subject of the page, a Middle Age coin. Ira Leviton (talk) 18:35, 25 February 2020 (UTC)
- 1 - Durgapur Barrage - (probably OK: wikt:warer): corrected to water. Ira Leviton (talk) 18:35, 25 February 2020 (UTC)
- 5 - Dutch guilder - wikt:rooi(tj: written deliberately to show an alternative Dutch spelling. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 2 - Duttaphrynus hololius - (probably OK: wikt:hololus): corrected to hololius. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 8 - Dynamic Language Runtime - wikt:the .NET, wikt:Basic .NET, wikt:shipped .NET, wikt:of .NET, wikt:the .NET, wikt:the .NET, wikt:a .NET, wikt:the .NET: software jargon. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 1 - Dynamic debugging technique - wikt:the .EXE: a software suffix. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 1 - Dynamic syntax tree - wikt:from .NET: software suffix. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 6 - Dynamic-link library - wikt:a .DRV, wikt:with .EXE, wikt:promotes .NET, wikt:the .lib, wikt:a .DEF, wikt:the .exe: software suffixes. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 3 - Dynamsoft - wikt:Dynamic .NET, wikt:A .NET, wikt:and .NET: software jargon. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 1 - Défi mini-putt - wikt:tounements: corrected to tournaments. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
- 19 - Dōka - wikt:you, wikt:your, wikt:you, wikt:you, wikt:you, wikt:you, wikt:your, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:you, wikt:your: all in translations. Ira Leviton (talk) 22:59, 25 February 2020 (UTC)
TS+COMMA+
[edit]- 3 - D-Man-alpha-(1-3)-D-Glc-beta-(1-4)-D-Glc-alpha-1-diphosphoundecaprenol 2-beta-glucuronyltransferase - wikt:ditrans,octacis, wikt:ditrans,octacis, wikt:ditrans,octacis - chemistry notation Strickesel (talk)
- 1 - DTDP-4-amino-4,6-dideoxy-D-glucose transaminase - wikt:diphospho-4-amino-4,6-dideoxyglucose - chemistry notation Strickesel (talk)
- 1 - Dabestan-e Mazaheb - wikt:your - in a quote, fixed quotation marks Strickesel (talk)
- 1 - Daisaku Ikeda - wikt:人間主義の大世紀を―わが人生を飾れ - correct japanese, as far as I can tell Strickesel (talk)
- 1 - Dan Halsted - wikt:here's - part of a title Strickesel (talk)
- 1 - Dan Linfoot - (probably OK: wikt:debút) - changed to debut Strickesel (talk)
- 2 - Daniel Steven Crafts - wikt:your, wikt:your - both part of a title Strickesel (talk)
- 1 - Danijela Stefanović - wikt:istoriji - part of a book title, serbian I think Strickesel (talk)
- 1 - Danny Boome - wikt:your, wikt:your - in a quote, fixed quotation marks Strickesel (talk)
- 1 - Danny Cannon - wikt:how's - show's Strickesel (talk)
- 1 - Danny Milosevic - wikt:you - "pay as you play contract", put it into quotation marks Strickesel (talk)
- 1 - Danube Vilayet - wikt:Dunavska(ta - part of a translation Strickesel (talk)
- 1 - Darren Wyse - wikt:how's - show's Strickesel (talk)
- 3 - Data & Analysis Center for Software - wikt:you, wikt:your (probably OK: wikt:I've) - all of these are in semi-quotes, put them in quotation marks Strickesel (talk)
- 1 - Dave Holmes (sportscaster) - wikt:how's - show's Strickesel (talk)
- 1 - Davenport Neck - (probably OK: wikt:brotherinlaw) - changed to brother-in-law Strickesel (talk)
- 1 - David E. Cooper - wikt:he's - Nietzsche's Strickesel (talk)
- 1 - David Nunn Fisher - wikt:he's - Blanche's Strickesel (talk)
- 1 - David Westhead - wikt:he's - part of a title Strickesel (talk)
- 1 - Davidson Garrett - wikt:how's - show's Strickesel (talk)
- 1 - Dead Cities, Red Seas & Lost Ghosts - wikt:DeadCities,RedSeas - stylized version without spaces Strickesel (talk)
- 4 - Death of the Doctor - wikt:artron, wikt:artron, wikt:artron, wikt:artron - term from this universe Strickesel (talk)
- 1 - Debjani Chatterjee - wikt:you - part of a title Strickesel (talk)
- 3 - Decaprenyl-phosphate phosphoribosyltransferase - wikt:trans,octacis, wikt:trans,octacis, wikt:trans,octacis - chemical notation Strickesel (talk)
- 3 - Decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase - wikt:trans,octacis, wikt:trans,octacis, wikt:trans,octacis - chemical notation Strickesel (talk)
- 1 - Dedekind sum - wikt:ad,bd, wikt:ad,bd - mathematical notation Strickesel (talk)
- 1 - Dehydroalanine - wikt:derivative—3,5-dihydro-5-methyldiene-4H-imidazol-4-one—that - removed derivative and that, rest is a chemical notation Strickesel (talk)
- 1 - Deivamagal - wikt:how's - show's Strickesel (talk)
- 2 - Delhi in a Day - wikt:here's, wikt:you - in a quote, put in quotation marks Strickesel (talk)
- 1 - Delta11-fatty-acid desaturase - wikt:CoA,hydrogen - chemical notation Strickesel (talk)
- 3 - Delta12-fatty-acid desaturase - wikt:CoA,hydrogen, wikt:Delta12(omega6 - chemical notation Strickesel (talk)
- 1 - Democrat Party (Thailand) - wikt:it's - Abhitit's Strickesel (talk)
- 1 - Demy (singer) - (probably OK: wikt:fanky) - changed to funky Strickesel (talk)
- 1 - Denotational semantics - wikt:E1,E2 - mathematical notation Strickesel (talk)
- 1 - Deoxyhypusine monooxygenase - wikt:deoxyhypusine,hydrogen - chemical notation Strickesel (talk)
- 1 - Derek Pell - wikt:decenterization - a real word, I think Strickesel (talk)
- 2 - Derrygonnelly Harps GAC - wikt:gConaile - maybe OK, but should be checked by someone knowledgable in Irish language
- 1 - Desulfobacter hydrogenophilus - wikt:Cis-9,10-methylenehexadecanoic - chemical notation
- 4 - Desymmetrization - wikt:PhCH(OH, wikt:cis-3,5-diacetoxycyclopentene (probably OK: wikt:desymmetrisations, wikt:hydrobenzoin) -all OK, chemical notations and a plural
- 2 - Dhanga, Bihar - wikt:panchait, wikt:hatbarya - don't know what I should change these words to Strickesel (talk)
- 5 - Dhobi - wikt:hathwal, wikt:hathwal, wikt:ataks, wikt:ataks, wikt:hathwal - don't think those are typos, but not sure Strickesel (talk)
- 3 - Diadenosine hexaphosphate hydrolase (AMP-forming) - wikt:P1,P6, wikt:P1,P6, wikt:P1,P5 - chemical notations Strickesel (talk)
- 4 - Diadenosine hexaphosphate hydrolase (ATP-forming) - wikt:P1,P6, wikt:P1,P6, wikt:P1,P5, wikt:P1,P4 - chemical notations Strickesel (talk)
- 2 - Diamine transaminase - wikt:alpha,omega, wikt:alpha,omega - chemical notations, I think Strickesel (talk)
- 2 - Dick O'Neill -
wikt:Mysteries,Three,- fixed previous - Jkgree (talk) 20:59, 25 February 2020 (UTC) , but left the following: wikt:he's - this one's part of a title Strickesel (talk) - 1 - Diethylthiambutene - wikt:N-Diethyl-1-methyl-3,3-di-2-thienylallylamine - chemical notation Strickesel (talk)
- 5 - Dimethylhistidine N-methyltransferase - wikt:Nalpha,Nalpha, wikt:Nalpha,Nalpha, wikt:Nalpha,Nalpha, wikt:Nalpha,Nalpha, wikt:Nalpha,Nalpha - chemical notation Strickesel (talk)
- 1 - Dimethylmalate dehydrogenase - wikt:beta,beta - chemical notation Strickesel (talk)
- 1 - Dimethylthiambutene - wikt:N-Dimethyl-1-methyl-3,3-di-2-thienylallylamine - chemical notation Strickesel (talk)
- 1 - Disappearance of Royal Marine Alan Addis - wikt:it's - unit's Strickesel (talk)
- 1 - Disney Parks Christmas Day Parade - wikt:how's - show's JaAlDo (talk)
- 2 - Ditrans,polycis-polyprenyl diphosphate synthase ((2E,6E)-farnesyl diphosphate specific) - wikt:Ditrans,polycis, wikt:ditrans,polycis - chemical notations JaAlDo (talk)
- 3 - Donemana - wikt:Curry,Irish, amana[gh, amana[gh: written deliberately to show alternative Gaelic spelling. Ira Leviton (talk) 19:13, 26 February 2020 (UTC)
- 1 - Donna Feldman - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 19:13, 26 February 2020 (UTC)
- 1 - Donna Martin - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 19:13, 26 February 2020 (UTC)
- 6 - Drobnjaci - wikt:starinci, wikt:katuns specific terminology related to the subject JaAlDo (talk) 15:20, 5 March 2020 (UTC)
- 1 - Durio kutejensis - (probably OK: wikt:substorey) - not sure if okay Strickesel (talk)
TS+BRACKET+
[edit]- 6 - D electron count - Ar]4s, Ar]4s, Ar]4s, Ar]4s, wikt:hexamminecobalt(III, wikt:nickel(II - chemical notations Strickesel (talk)
- 4 - D-DIA - wikt:dm(hkl, wikt:dp(hkl, wikt:GR(HKL, wikt:gasketing - chemical notations, and the adjective for 'gasket' it seems Strickesel (talk)
- 4 - D-alanine—poly(phosphoribitol) ligase - wikt:poly(ribitol, wikt:poly(ribitol, wikt:poly(ribitol, wikt:poly(ribitol - chemical notations Strickesel (talk)
- 1 - D-arabinose 1-dehydrogenase - wikt:arabinose(fucose - chemical notations Strickesel (talk)
- 5 - D-aspartate ligase - wikt:Ac(oyl, wikt:Ac(oyl, wikt:Mur2Ac(oyl, wikt:Mur2Ac(oyl, wikt:Mur2Ac(oyl - chemical notations Strickesel (talk)
- 2 - D-bifunctional protein deficiency - wikt:pristinic, wikt:pristinic - might be okay Strickesel (talk)
- 1 - D-xylulose reductase - wikt:polyol(DPN - chemical notations Strickesel (talk)
- 2 - D. Babu Paul - wikt:omoyde, wikt:briro - the name of a book and an award, respectively Strickesel (talk)
- 2 - DATP(dGTP)—DNA purinetransferase - wikt:dATP(dGTP, wikt:dATP(dGTP - chemical notations Strickesel (talk)
- 1 - DB locomotive classification - wikt:sub)class - correct Strickesel (talk)
- 1 - DBN1 - wikt:tm1b(KOMP - chemical notations Strickesel (talk)
- 1 - DBrn - wikt:dB(rn - some kind of notation Strickesel (talk)
- 1 - DCBLD2 - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- 1 - DCC1 - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- 1 - DCTN5 - wikt:tm2a(KOMP - chemical notations Strickesel (talk)
- 1 - DCVG - wikt:copper(II - chemical notations Strickesel (talk)
- 1 - DDX27 - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- 1 - DDX42 - wikt:tm1b(EUCOMM - chemical notations Strickesel (talk)
- 1 - DECserver - DECSERVER]DS5CFG - computational notations Strickesel (talk)
- 2 - DFNB31 - wikt:tm1a(EUCOMM, wikt:tm1a(EUCOMM - chemical notations Strickesel (talk)
- 1 - DIP2A - wikt:tm2b(KOMP - chemical notations Strickesel (talk)
- 1 - DIP2B - wikt:tm1a(EUCOMM - chemical notations Strickesel (talk)
- 1 - DIPAMP - wikt:anisyl(phenyl - chemical notations Strickesel (talk)
- 2 - DJMax Portable 3 - wikt:you, wikt:your - in song titles Strickesel (talk)
- 1 - DLG3 - wikt:tm1a(EUCOMM - chemical notations Strickesel (talk)
- 1 - DMC1 (gene) - wikt:Tid1(Rdh54 - chemical notations Strickesel (talk)
- 1 - DNA (cytosine-5)-methyltransferase 3A - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- 2 - DNA ligase (NAD+) - wikt:poly(deoxyribonucleotide, wikt:poly(deoxyribonucleotide - chemical notations Strickesel (talk)
- 3 - DNA topoisomerase - wikt:magnesium(II, wikt:magnesium(II, wikt:magnesium(II - chemical notations Strickesel (talk)
- 6 - DNA-binding metallo-intercalators - wikt:Ru(bpy, wikt:Ru(phen, wikt:Ru(bpy, wikt:Ru(bpy, wikt:Ru(bpy, wikt:Ru(phen - chemical notations Strickesel (talk)
- 1 - DNA-deoxyinosine glycosylase - wikt:DNA(hypoxanthine - chemical notations Strickesel (talk)
- 1 - DNASE1L2 - wikt:tm1(KOMP - chemical notations Strickesel (talk)
- 1 - DNPEP - wikt:tm1e(EUCOMM - chemical notations Strickesel (talk)
- 1 - DOK1 - wikt:p210(bcr - chemical notations Strickesel (talk)
- 1 - DOK2 - wikt:p210(bcr - chemical notations Strickesel (talk)
- 1 - DPM1 - wikt:tm1b(KOMP - chemical notations Strickesel (talk)
- 1 - DUSP3 - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- 1 - DUSP5 - wikt:tm1a(KOMP - chemical notations Strickesel (talk)
- Dadakuada - wikt:ijala - ok
- Dagan languages - wikt:obosa, wikt:kumbutu - ok
- Damacharla Janardhana Rao - (not OK: wikt:balneni - proper name Balineni)
- 3 - Dan Ariely - wikt:Dis)Honesty, wikt:Dis)Honesty - Title of his book.
- 1 - Dan Hurlin - wikt:No(thing - title of work
- 1 - Dan Starkey (actor) - wikt:Five(ish - name of a TV program. It should have been picked up in the title of a Wikipedia page
- 2 - Dancing in the Dark (Howard Dietz and Arthur Schwartz song) - (probably OK: wikt:I've) - Title of an album
- 2 - Daporijo - wikt:yullo - Name of a festival
- 5 - Dark Age of Camelot - probably OK: wikt:mythrians, wikt:mythirians - creatures in the game JaAlDo (talk) 21:26, 9 March 2020 (UTC)
- 4 - Darul Uloom Al-Madania - wikt:eAlim, wikt:eAlim, wikt:eAlim - name of a course
- 4 - DarkComet - Trojan[Backdoor - computer file name JaAlDo (talk) 21:29, 9 March 2020 (UTC)
- 2 - Data validation - wikt:substr(Middle_Name: software programming code. Ira Leviton (talk) 02:41, 27 February 2020 (UTC)
- 4 - Database index - wikt:reverse(email_address: software programming code. Ira Leviton (talk) 02:41, 27 February 2020 (UTC)
- 1 - Dave Couse - Hyper[borea: the name of a band. Ira Leviton (talk) 02:41, 27 February 2020 (UTC)
- 1 - Dave Hull - wikt:Mis)Adventures: part of a title. Ira Leviton (talk) 02:41, 27 February 2020 (UTC)
- 2 - David Blackburn (artist) - transform[ed: in a quotation. Ira Leviton (talk) 02:36, 28 February 2020 (UTC)
- 1 - David C. Hilmers - wikt:VMA(AW: United States Navy jargon. Ira Leviton (talk) 02:36, 28 February 2020 (UTC)
- 2 - David Camorlinga Tagle - (probably OK: wikt:linksSebastián): corrected, the Sebastian was stray, they are two words. Ira Leviton (talk) 02:36, 28 February 2020 (UTC)
- 1 - David Cardwell - wikt:RE)BCO: undefined jargon. I couldn't fix it, so I put a clarify tag on it. Ira Leviton (talk) 02:36, 28 February 2020 (UTC)
- 1 - David E. Davis - wikt:let's: inadvertent detection of "Chevrolet's". Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 1 - David Harvey - wikt:re)creation: written deliberately. Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 1 - David J. Schmidly - wikt:un)Occupy: written deliberately. Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 1 - David Schramm (actor) wikt:how's: inadvertent detection of "show's".
- 1 - David Stone (military historian) - afford[ed: written deliberately to paraphrase a quotation. Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 1 - David Troughton - wikt:Five(ish: a word in the title of a play. Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 1 - David Wills (writer) - wikt:De)construct: a word in the title of a book. Ira Leviton (talk) 19:28, 28 February 2020 (UTC)
- 2 - Day–Stout–Warren algorithm - wikt:tree(root, wikt:compress(root: software coding. Ira Leviton (talk) 16:59, 29 February 2020 (UTC)
- 1 - De Smet Jesuit High School - wikt:it's: inadvertent detection of "Jesuit's".
- 1 - De arte aleae - Lib[er: from a quotation. Ira Leviton (talk) 18:23, 29 February 2020 (UTC)
- 3 - De'VIA - wikt:Ame(rican, wikt:Lan(guage: both used to demonstrate a word root. Ira Leviton (talk) 18:23, 29 February 2020 (UTC)
- 1 - Deacon process - wikt:ruthenium(IV: chemistry notation. Ira Leviton (talk) 19:41, 29 February 2020 (UTC)
- 2 - Dear God (XTC song) - wikt:re)Production, wikt:re)Production: the name of an album. Ira Leviton (talk) 19:41, 29 February 2020 (UTC)
- 1 - Deborah Watling - wikt:Five(ish: a word in the title of a TV show. Ira Leviton (talk) 19:41, 29 February 2020 (UTC)
- 1 - Debra Yepa-Pappan - wikt:Dual(ing: a word in the title of an artwork. Ira Leviton (talk) 19:41, 29 February 2020 (UTC)
- 1 - Debug new - wikt:new(__FILE__: software jargon. Ira Leviton (talk) 19:41, 29 February 2020 (UTC)
- 3 - Decaborane - wikt:decaborane(14, wikt:decaborane(14, wikt:Decaborane(14: chemistry notation. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 7 - Decamethylferrocene - wikt:iron(II, wikt:iron(II, wikt:iron(II, wikt:iron(III, wikt:iron(IV: chemistry notation. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 2 - Decarbonylation - wikt:LFe(CO: part of a chemical formula. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 3 - Dechloromonas agitata strain CKB - wikt:per)chlorate, wikt:per)chlorate, wikt:per)chlorate: chemistry jargon. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 1 - Dechloromonas hortensis - wikt:per)chlorate: chemistry jargon. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 3 - Decomplexation - wikt:arene)Cr, wikt:arene)Cr: chemistry jargon. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 2 - Dedicated 2 the Oldies 2 - wikt:he's: part of a song title. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 1 - Deena Errampalli - (probably OK: wikt:statellite): corrected to satellite. Ira Leviton (talk) 20:23, 29 February 2020 (UTC)
- 2 - Deferasirox - wikt:yl)benzoic: part of a chemical name. Ira Leviton (talk) 21:54, 29 February 2020 (UTC)
- 1 - Degree symbol - space]b0: software jargon. Ira Leviton (talk) 21:54, 29 February 2020 (UTC)
- 4 - Dehalogenation - wikt:manganese(II, wikt:Fe(acac, wikt:radicophiles: chemistry notation. Ira Leviton (talk) 21:54, 29 February 2020 (UTC)
- 5 - Deinococcus radiodurans - wikt:manganese(II, wikt:radiophilus: chemistry notation and genus name Deinococcus radiophilus". Ira Leviton (talk) 21:54, 29 February 2020 (UTC)
- 4 - Delay composition - wikt:tin(IV, wikt:bismuth(III, wikt:lead(II, wikt:lead(IV: chemistry notations. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 3 - Della Rovere Chapel (Santa Maria del Popolo) - CARD[INALI, VIRG[INIS: demonstrating a historical inscription with abbreviations. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Delph - wikt:ge)delf: intentional, apparently to show more than one form of an Old English word. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Delphinidin-3-O-(6-p-coumaroyl)glucoside - wikt:coumaroyl)glucoside: part of a chemical name. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Delta Delphini - wikt:kA7hF0mF0(IV: an astronomical designation of a star. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Delta bond - wikt:octachlorodirhenate(III: chemistry notation. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Deluhi - Visual[ism: part of an album name. Ira Leviton (talk) 22:32, 29 February 2020 (UTC)
- 1 - Demetrius III Eucaerus - Deme]trius: translation of an inscription with an abbreviation. Ira Leviton (talk) 18:59, 1 March 2020 (UTC)
- 2 - Demochristian Party of Albania - wikt:CDPA)develops (probably OK: wikt:jubily): typo help inline tag added. Ira Leviton (talk) 18:59, 1 March 2020 (UTC)
- 4 - Demoxytocin - wikt:acid)oxytocin: part of a chemical name.
- 9 - Dempster–Shafer theory - wikt:Bel(red, wikt:Bel(green, wikt:Bel(red: mathematical notation. Ira Leviton (talk) 18:59, 1 March 2020 (UTC)
- 2 - Dendralene - wikt:copper(II, wikt:ivyanes: chemistry terminology and a plural chemical name. Ira Leviton (talk) 20:02, 1 March 2020 (UTC)
- 5 - Denigés' reagent - wikt:mercury(II, wikt:mercury(II: chemistry notation. Ira Leviton (talk) 20:02, 1 March 2020 (UTC)
- 6 - Densha Otoko (TV series) - wikt:you, wikt:you: both are part of "thank you", mentioning a thank you present. Ira Leviton (talk) 20:02, 1 March 2020 (UTC)
- 2 - Desiccant - wikt:hexaaquacobalt(II: chemistry notation. Ira Leviton (talk) 01:03, 2 March 2020 (UTC)
- 1 - Detachment (territory) - at]tach: written to show a word derivation. Ira Leviton (talk) 01:03, 2 March 2020 (UTC)
- 5 - Detroit International Riverfront - wikt:it's: inadvertent detection of "Detroit's"".
- 4 - Developmental toxicity - (probably OK: wikt:cavitaion): corrected to cavitation. Ira Leviton (talk) 02:18, 2 March 2020 (UTC)
- 1 - Device independence - wikt:FORMAT(A20: software programming language. Ira Leviton (talk) 02:18, 2 March 2020 (UTC)
- 2 - Dextromoramide - wikt:diphenylbutyryl)pyrrolidine, wikt:moramides: chemical terms, the latter is plural. Ira Leviton (talk) 02:18, 2 March 2020 (UTC)
- 1 - Dextrose equivalent - wikt:copper(II: chemical notation. Ira Leviton (talk) 02:18, 2 March 2020 (UTC)
- 2 - Dhaasippen - wikt:thumbhai, wikt:thumbhai: the local name for a certain flower. Ira Leviton (talk) 03:41, 2 March 2020 (UTC)
- 2 - Dhamaal - wikt:Manav(Javed, wikt:it's: inadvertent detection of "Dacoit's".
- 1 - Dhamtari - wikt:morabulum: seems to be a local name for a tree or nut. Ira Leviton (talk) 03:41, 2 March 2020 (UTC)
- 1 - DiDi - wikt:ʈʂʰúɕɪ̌ŋ: this is supposed to show pronunciation. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 10 - Diabetes and deafness - wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR, wikt:tRNALeu(UUR: molecular biology jargon. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 2 - Diallyl disulfide - wikt:di(alkylthio: part of a chemical name. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 2 - Diaminohydroxyphosphoribosylaminopyrimidine deaminase - wikt:phosphoribosylamino)uracil, wikt:phosphoribosylamino)uracil: parts of chemical names. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 1 - Diazodiphenylmethane - wikt:mercury(II: chemical notation. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 1 - Dibenzylideneacetone - wikt:tris(dibenzylideneacetone: part of a chemical name. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 1 - Dibromine monoxide - wikt:mercury(II: chemical notation. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 2 - Dibutyltin dilaurate - wikt:dibutyltin(IV, wikt:hexamitosis: a chemical notation and a parasitic disease of birds. Ira Leviton (talk) 20:11, 2 March 2020 (UTC)
- 1 - Dicarbonyl(acetylacetonato)rhodium(I) - wikt:Dicarbonyl(acetylacetonato: part of a chemical name. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 3 - Dicarbonyltris(triphenylphosphine)ruthenium(0) - wikt:ruthenium(II, wikt:ruthenium(II: chemical notations.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dichlorine heptoxide - wikt:chlorine(VII: chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dichlorine monoxide - wikt:mercury(II: chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dichloro(1,2-bis(diphenylphosphino)ethane)nickel - wikt:nickel(II: part of a chemical name and a chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 2 - Dichloro(1,3-bis(diphenylphosphino)propane)nickel - propane]nickel, wikt:nickel(II: chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dichloro(cycloocta-1,5-diene)platinum(II) - wikt:Pt(cod: part of a chemical name. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 4 - Dichlorobis(ethylenediamine)nickel(II) - wikt:nickel(II, wikt:Ni(en, wikt:Ni(en, wikt:nickel(II: chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 4 - Dichlorobis(triphenylphosphine)nickel(II) - wikt:nickel(II, wikt:nickel(II, wikt:nickel(II, wikt:nickel(II: chemical notations.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dichlorotetrakis(dimethylsulfoxide)ruthenium(II) - wikt:ruthenium(II: chemical notation.Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 3 - Dicistroviridae - wikt:Hel(helicase, wikt:Pro(protease, wikt:RdRp(polymerase: molecular biology jargon. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 2 - Dicobalt edetate - wikt:Co(EDTA, wikt:Co(EDTA: chemical abbreviation. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 4 - Dicoronylene - benzo[10, bc]coronene: part of a chemical name. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Dictionary of American Naval Aviation Squadrons - wikt:VP(AM: U.S. Navy jargon. Ira Leviton (talk) 22:35, 2 March 2020 (UTC)
- 1 - Diene - wikt:butadiene)iron: part of a chemical name. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 4 - Diethylaluminium cyanide - bis[di, wikt:Bis(tert: parts of chemical names. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 3 - Diethylaminosulfur trifluoride - wikt:difluoro(morpholino: part of a chemical name. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Diethylenetriamine - wikt:Co(dien: part of a chemical name. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Diethylethanolamine - wikt:cyclo(CH: part of a chemical name. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Diethylphosphite - wikt:phosphorus(III: chemical notation. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Dieudonné determinant - wikt:det(AB: part of a mathematical notation. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 5 - Diferric-transferrin reductase - transferrin[Fe, transferrin[Fe, transferrin[Fe, transferrin[Fe, transferrin[Fe: chemistry notation. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Different ideal - wikt:tr(xy: part of a mathematical notation. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 2 - Diglucosyl diacylglycerol synthase - wikt:glucopyranosyl)sn, wikt:glucopyranosyl)sn: parts of chemical names. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 4 - Dihydrolipoyllysine-residue (2-methylpropanoyl)transferase - wikt:dihydrolipoyl)lysine, wikt:dihydrolipoyl)lysine, wikt:dihydrolipoyl)lysine, wikt:dihydrolipoyl)lysine: parts of chemical names. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 2 - Dihydroorotate dehydrogenase - wikt:tm1b(EUCOMM, wikt:dystosis: molecular biology jargon and an arcane medical term. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Diindenoperylene - lm]perylene: part of a chemical name. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Diisopropyl ether - wikt:iron(II: chemistry notation. Ira Leviton (talk) 02:25, 3 March 2020 (UTC)
- 1 - Dille–Koppanyi reagent - wikt:cobalt(II: chemistry notation. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 1 - Dillo Dirt - wikt:cd)pyrene: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 1 - Dimanganese decacarbonyl - Na[Mn: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 2 - Dimension theorem for vector spaces - wikt:dim(range, wikt:dim(kernel: mathematical formula jargon. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 1 - Dimetamine - wikt:tolyl)cyclohexanone: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 1 - Dimethylargininase - wikt:oxide(NO: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 4 - Dimethyldichlorosilane - HO[Si, wikt:nHO(CH, wikt:SiRSi(CH, wikt:SiRSi(CH: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 1 - Dimethylglyoxime - wikt:Ni(dmgH: part of a chemical name. Ira Leviton (talk) 02:33, 4 March 2020 (UTC)
- 2 - Diocese of Buto - wikt:Butien(sis: showing a Latin noun form. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 1 - Diocese of Moldovița - wikt:Moldavien(sis: showing a Latin noun form. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 2 - Diode–transistor logic - wikt:CE(sat: part of a mathematical formula. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 4 - Diol - wikt:manganate(VII, wikt:manganate(VII, wikt:RCH(OH, wikt:dioyl: chemistry notations. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 4 - Dipeptide - wikt:RCH(NHP, wikt:RCH(NHP, wikt:NH(CHR: parts of chemical formulas. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 1 - Dipeptidyl-peptidase II - wikt:dipeptidyl(amino: part of a chemical name. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 3 - Diphenyl disulfide - wikt:CH(SPh, wikt:lead(IV:: chemistry formulas/notation. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 3 - Diphenylethylenediamine - wikt:cymene)Ru, wikt:PhCH(OH: parts of chemical formulas. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 16 - Diphosphagermylene - wikt:fluorosilyl)silylphosphanides: part of a chemical name. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 1 - Diphosphorus tetroxide - wikt:phosphorus(III: chemistry notation. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 1 - Diphtheria toxin - wikt:ribosyl)diphthamide: part of a chemical formula. Ira Leviton (talk) 14:43, 4 March 2020 (UTC)
- 1 - Dir En Grey discography - Vulgar[ism: part of a song name. Ira Leviton (talk) 02:53, 5 March 2020 (UTC)
- 1 - Direct Consular Filing - wikt:Widow(er: in a title of a form, so it applies to both widows and widowers. Ira Leviton (talk) 02:53, 5 March 2020 (UTC)
- 2 - Direct bonding - wikt:Si(OR: chemical notation. Ira Leviton (talk) 02:53, 5 March 2020 (UTC)
- 2 - Dirichlet density - wikt:log(10, wikt:let's: mathematical notation and inadvertent detection of "Dirichlet's".
- 1 - Disney Digital Network - wikt:how's: inadvertent detection of "show's". Ira Leviton (talk) 04:06, 5 March 2020 (UTC)
- 1 - Disulfur difluoride - wikt:Silver(II: chemistry notation. Ira Leviton (talk) 16:55, 5 March 2020 (UTC)
- 3 - Dithiocarbamate - Na[CH: chemistry notation. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 3 - Dithionite - wikt:iron(III, wikt:iron(II, wikt:iron(III: chemistry notations. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 5 - Ditungsten tetra(hpp) - wikt:ditungsten(II, wikt:tetra(hpp, wikt:copper(II: chemistry notations. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 2 - Diversi-Dial - wikt:unBlitz: the name of a software program. Ira Leviton (talk)
- 5 - Divorce law by country - wikt:widow(er, wikt:widow(er: written deliberately to show widow and widower in law. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 2 - Do Me (Koda Kumi song) - wikt:re(LIVE, wikt:re(CORD: names of songs. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 1 - Dobama's Night Kitchen - wikt:LUV(SIC: the name of a song. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 3 - Doctor Who (2013 specials) - wikt:Five(ish, wikt:Five(ish, wikt:how's: in the name of a show, and inadvertent detection of the word "show's". Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 1 - Document International Human Rights Documentary Film Festival - wikt:sh(OUT: part of the name of an artwork. Ira Leviton (talk) 02:12, 6 March 2020 (UTC)
- 1 - Doebner–Miller reaction - wikt:scandium(III: chemistry notation. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 2 - Dolní Marklovice - wikt:ow)ice, wikt:ow)itz: demonstrating Slavic word endings. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 1 - Domebo Canyon, Oklahoma - wikt:sphaerids: seems legit. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 3 - Domenico and Francesco Pizzigano - wikt:Ge)rardus, wikt:rardus, wikt:rardus: from partial inscriptions in a medieval document. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 2 - Domestication of the Syrian hamster - wikt:BM(NH, wikt:hamsteries: a museum designation written in jargon, and a legitimate plural word.Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 2 - Domnus of Pannonia - wikt:Stribon(ensis, wikt:Stridon(ensis: alternative Latin word forms. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 3 - Domžale - wikt:Domsell(sdorf, wikt:unselsdorf: partial words, being used to show word derivations. Ira Leviton (talk) 03:04, 6 March 2020 (UTC)
- 2 - Donald R. Paul - wikt:Poly(ethylene, wikt:Poly(ethylene: chemistry notations. Ira Leviton (talk) 04:11, 7 March 2020 (UTC)
- 1 - Dopamine receptor D4 - wikt:yl)propanone: part of a chemical name. Ira Leviton (talk) 20:27, 7 March 2020 (UTC)
- 1 - Dose–response relationship - wikt:log(dose: mathematical formula. Ira Leviton (talk) 20:27, 7 March 2020 (UTC)
- 1 - Double exponential moving average - wikt:EMA(EMA: mathematical notation. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 2 - Douglas F4D Skyray - wikt:VMF(AW, wikt:VMF(AW: United States Navy jargon. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 1 - Douglas Ferguson (artist) - wikt:he's: inadvertent detection of "Forsythe's". Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 2 - Douglas G. Hurley - wikt:VMFA(AW, wikt:VMFA(AW: United States Navy jargon. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 1 - Douglas T. Kenrick - wikt:non)conformity: part of a journal article title. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 1 - Dove (toiletries) - wikt:regret(ed: fixed spelling to regret(ted)"; it's from a quotation. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 1 - Downtown Community House - prod[ded: brackets used to clarify a quotation. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 1 - Doyle–Kirmse reaction - wikt:furyl)carbenoids: chemistry jargon. Ira Leviton (talk) 21:44, 7 March 2020 (UTC)
- 2 - Drakens Gränd - gr[änd: written deliberately. Ira Leviton (talk) 20:49, 9 March 2020 (UTC)
- 1 - Dresden Triptych - OM]PLEVIT: from an old inscription. Ira Leviton (talk) 20:49, 9 March 2020 (UTC)
- 1 - Driving America Forward Act - get[ting: paraphrasing a quotation. Ira Leviton (talk) 01:13, 10 March 2020 (UTC)
- 1 - Driving licence in Hong Kong - wikt:class(es: quoting a law. Ira Leviton (talk) 01:13, 10 March 2020 (UTC)
- 1 - Dropull - wikt:Hadrianopolitan(us: showing a Latin ending. Ira Leviton (talk) 01:13, 10 March 2020 (UTC)
- 1 - Drosera katangensis - wikt:B2ab(iii: quoting subsection of law. Ira Leviton (talk) 01:13, 10 March 2020 (UTC)
- 1 - Dubai 33 - wikt:here's - part of a title Strickesel (talk)
- 2 - Duncan Barrett - avoid[ing, wikt:your: in single quotes, put them in double Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 1 - Dura, Africa - wikt:Duren(sis: some sort of Latin addition to the end of a word. Not sure what to do with it Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 3 - Dutch Indies literature -
wikt:Rubber(1931(probably OK: wikt:kampsyndroom, wikt:haarwrong): Dutch language titles Whisperjanes (talk) 06:26, 8 March 2020 (UTC) - 3 - Dutch exonyms - (probably OK: wikt:zevenburgen) - rare Dutch exonym of Transylvania Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 3 - Dutchbat - wikt:… (probably OK: wikt:draaginsigne): ... = in quotes; draaginsigne = name of insignia Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 1 - Dutton Guilt Edged Mysteries - wikt:Noir(ish: novel name Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 6 - Duty to rescue - (probably OK: wikt:unterlassene) - part of phrase in quotes Whisperjanes (talk) 06:26, 8 March 2020 (UTC)
- 1 - Dwarf corydoras - wikt:sub)tropical - correct Strickesel (talk)
- 2 - Dyadic Encoding - wikt:dya(2n, wikt:dya(2n - chemical notation Strickesel (talk)
- 1 - Dye decolorizing peroxidase - wikt:yl)amino - chemical notation Strickesel (talk)
- 1 - Dynamic mechanical analysis - wikt:poly(acrylonitrile - chemical notation Strickesel (talk)
- 3 - Dynamic scraped surface heat exchanger - wikt:semi)empirical, wikt:Fa(Re, wikt:Nu(Re - chemical notation Strickesel (talk)
- 3 - Dysplastic nevus syndrome - wikt:p16(INK4a, wikt:p14(ARF, wikt:p16(INK4 - chemical notation Strickesel (talk)
- 4 - Dysprosium - wikt:dysprosium(III, wikt:dysprosium(III, wikt:kozoite, wikt:dysprositos - chemical notation Strickesel (talk)
- 1 - Dysprosium acetylacetonate - wikt:Dy(acac - chemical notation Strickesel (talk)
- 2 - Dysprosium chloride - wikt:Dysprosium(II, wikt:Dysprosium(III - chemical notation Strickesel (talk)
- 5 - Dysprosium(III) chloride - wikt:Dysprosium(III, wikt:Dysprosium(III, wikt:dysprosium(III, wikt:dysprosium(III, wikt:Dysprosium(III - chemical notation Strickesel (talk)
- 1 - Dysprosium(III) oxide - wikt:dysprosium(III - chemical notation Strickesel (talk)
- 1 - Dystis - wikt:Dystien(sis - correct Strickesel (talk)
- 2 - Dzikie Pola (role-playing game) - wikt:dis)advantages, wikt:szablas - correct Strickesel (talk)
- 1 - Dülük - wikt:Dolichen(us - correct Strickesel (talk)
Case notes (D) from 2018-11-01 dump
[edit]- 2 - DC Universe Online - wikt:exobytes, wikt:exobytes: a robot-like device in the DC Universe Online game.
- 1 - DCTN2 - wikt:dynamitin a subunit of dynactin, a macromolecular complex involved in several cellular functions.
- 2 - DJ Brace - wikt:maticulous, wikt:maticulous: The name of one of this DJ's albums, spelled with a small 'm', too.
- 1 - Dale Hample - wikt:inventional: meaning the act of inventing. A bit specialized, but legitimate.
- 1 - Daniela Poggi - wikt:quoio: Italian?
- 2 - Daniele Trinchero - wikt:iXem, wikt:iXem: name of a company.
- 1 - Danny Deever - wikt:undred: written as " 'undred" (meaning "hundred") in a poem.
- 1 - Danny Devos - wikt:browntones: a musical term.
- 1 - Dansker - wikt:danzker: an alternative spelling of the subject of the page.
- 1 - Darren Soto - wikt:eMgage: name of a Democratic political action committee.
- 1 - Darwin Jones - wikt:unsolveable: in a quotation. There's no access to the original source, a comic book, so I have no way to check if it appeared with that spelling.
- 19 - Dashiki - wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshiki, wikt:danshikis, wikt:danshiki, wikt:danshikis: legit - but not English. It's a Hausa word, from which dashiki, the subject of the page, is derived.
- 1 - Dave (surname) - wikt:duvea: ISO lang code for Middle Indo-Aryan?
- 1 - David Grant (producer) - wikt:sextoon: meant as a sex cartoon. Not sure if it's a real word.
- 1 - David Tall - wikt:procepts: plural of procept.
- 1 - Daydream (1964 film) - wikt:eroductions: an 1960s term for soft porn.
- 1 - De Garde Brewing - wikt:foeders: a term for barrel. Maybe archaic.
- 1 - De Morgan - wikt:tilist: a ceramics worker who works with tiles.
- 2 - De Stille Kracht (TV series) - wikt:goena, wikt:goena: a Dutch or Indonesian word.
- 3 - DeSoL - wikt:saZon, wikt:saZon, wikt:saZon: the name of a record company. It's correct.
- 5 - Dead Before Dawn - wikt:zemons, wikt:zemons, wikt:zemons, wikt:zemons, wikt:zemons: a combination of zombie and demon, a type of creature in the movie that's the subject of the page.
- 1 - Dead Weather Machine - wikt:respiritory. Misspelled, followed by a [sic].
- 1 - Deb Pearce - wikt:foQus: in a song title. With a capital Q.
- 1 - Deb Verhoeven - wikt:kinomatics: probably not a real word, but it's in a reference.
- 1 - Decoder Ring Theatre - wikt:xenocidal: adjectival form of xenocide. Legit.
- 1 - Deed - wikt:sanads: plural of sanad, a deed granted to the rulers of princely states in British India. Not an English word, though.
- 1 - Deep Navigation Colliery - wikt:byats: unclear. -- OK, wikt:Appendix:Dictionary of Mining, Mineral, and Related Terms/B/3 has "biat", also spelled "byat" Jkgree (talk) 16:27, 20 February 2019 (UTC)
- 1 - Deep Springs College - wikt:feedman: legit. A type of ranch hand or farm worker.
- 1 - Deep Springs Plantation - wikt:axatite: legit. A type of rock or mineral in a meteorite.
- 1 - Degaldoruwa Raja Maha Vihara - wikt:digge: a word from a language used on the Indian subcontinent, probably Tamil or Sinhalese.
- 1 - Deltras F.C. - wikt:furiest: I can't figure out what word is intended here -- furriest? most furious?
- 8 - Demoicracy - wikt:demoicratic, wikt:demoicratic, wikt:demoicrats, wikt:demoicratic, wikt:demoicratic, wikt:demoicratic, wikt:demoicratic, wikt:demoicratically. See the title of the page. A bit forced, but seems legit.
- 1 - Denis Sullivan (schooner) - wikt:raffee: a type of topsail. See topsail.
- 1 - Dennis Merzel - wikt:zuise: a Japanese word. See Zen ranks and hierarchy.
- 3 - Dentures - wikt:spruing, wikt:cusion, wikt:hndy: spruing needs Wiktionary addition? cleared other spelling errors
- 2 - Department of Archaeology - wikt:eology, wikt:eology: used correctly, as part of arch(a)eology.
- 1 - Deportivo Saprissa - wikt:choreos: no clue; it translates as "complaint" which doesn't make sense in context.
- 1 - Der König in Thule - wikt:goldnen: German for golden.
- 1 - Deserticossus janychar - wikt:stroky: unclear.
- 1 - Devil May Cry (video game) - wikt:jagginess: slang for a certain type of artifact in video or graphic images.
- 1 - Devlin v. Smith - wikt:otwithstanding: in a quotation, written as "[N]otwithstanding..."
- 1 - Dey - wikt:deylicate: a form of government of Algeria in the early 1800s.
- 1 - Dhumpa sangita - wikt:mardala: a musical instrument used in India?
- 2 - Diana (1818 ship) - wikt:buggalows, wikt:buggalows: plural, a type of boat mainly used in the Arabian Sea, similar to a dhow.
- 1 - Dick Turpin - wikt:higlers: an English term for a peddler or travelling seller of goods.
- 1 - Dillalah - wikt:yarron: a type of grass or vegetation in Australia. From a newspaper in reference #1 of the article.
- 1 - Direct memory access - wikt:deasserted: computer programming jargon. Probably not a real word.
- 1 - Discogs - wikt:taghycardia: a product name. With a small 't'.
- 1 - Dishwashing - wikt:gosok: unclear. I think it's an Indonesian term.
- 1 - Dithmarschen - wikt:warfts: plural for an artificial dwelling hill for protection from the sea. Similar to terps.
- 1 - Diving at the 1928 Summer Olympics – Men's 3 metre springboard - wikt:isander: a type of dive (confirmed on olympic's website)
- 1 - Diving at the 1932 Summer Olympics – Men's 10 metre platform - wikt:isander: a type of dive
- 1 - Divisional Secretariats of Sri Lanka - wikt:korales: a colonial district type in Sri Lanka
- 1 - Divona - wikt:deuos: Gaulic, according to article
- 1 - Diwan Singh - wikt:lehran: part of a book title, I capitalized it
- 1 - Djinguereber Mosque - wikt:alhore: unclear, I wasn't able to validate its meaning.
- 1 - Domhnall Ó hUiginn - wikt:reowned: unable to confirm correction with original source of quote ETA: I'm fairly certain the word is "renowned" so I made the change. Schazjmd (talk) 01:20, 26 December 2018 (UTC)
- 1 - Domina Eberle Spencer - wikt:holors: a mathematical entity that is made up of one or more independent quantities, or merates.
- 1 - Donikkl Mitmach-Konzert-Show - wikt:rockt: part of song title
- 1 - Dora Riparia - wikt:duriae: local dialect for canals, made italic
- 1 - Doree Lewak - wikt:reinforc: used in quote to modify tense ("reinforc(ing)"
- 1 - Dorothy Bishop - wikt:hookies: nickname for an award, mentioned in target wiki article, capitalized it to match target
- 1 - Dory Reeves - wikt:ownerhsip: spelled that way in dissertation title, article includes [sic]
- 2 - Doubled die - wikt:hubbings, wikt:hubbings: add to wiktionary?
- 5 - Douen - wikt:douens, wikt:douens, wikt:douens, wikt:douens, wikt:douens: add to wiktionary?
- 2 - Dragon Ball GT: Transformation - wikt:zenie, wikt:zenie: this is a thing in that game
- 3 - Dragoneer's Aria - wikt:lusces, wikt:lusces, wikt:lusces: this is a thing in that game
- 3 - Drinking from shoes - wikt:shoeys, wikt:shoeys, wikt:shoeys: plural for "shoey", an Australian term for drinking beer out of one's own shoe.
- 1 - Droit Chemin - wikt:ketsh: not sure which language in use
- 6 - Drua - wikt:druas, wikt:druas, wikt:druas, wikt:druas, wikt:druas, wikt:druas: plural form of the subject of the article
- 1 - Drug Equality Alliance - wikt:maladminstration: this is a word
- 2 - Dry ski slope - wikt:dendix, wikt:dendix: a type of fabric
- 1 - Dryinus rasnitsyni - wikt:clypus: scientific term for a part of a wasp's face
- 1 - Dual gauge - wikt:rollbocks: a type of train car, wiki has an article on it
- 1 - Dugu Miniautotoys - wikt:falcet: found this mentioned in other (non-wiki-mirror) articles and described there as a local dialect
- 1 - Dundgovi Province - wikt:mikrs: appears to be a term used in Mongolia for transit option, found on other (non-wiki-mirror) sites // may be non-English? -Xurizuri (talk) 06:26, 4 February 2021 (UTC)
- 1 - Duros (food) - wikt:durros: included as an alternate spelling of "duros"
- 1 - Dustobod - wikt:stobod: part of name (info box label, it's spelled as "Du'stobod")
- 1 - Dutch pacification campaign on Formosa - wikt:cangans: defined in article as a type of cloth
- 1 - Duvenstedt - wikt:stedt: used in "-stedt" to explain how name was formed
- 1 - Dyin' on a Prayer - wikt:woging - term from the show that the page is about. Monster transformation/glamor. Past/active tense verb 'changing/maintaining a form.' Source: Fan wiki... help?
- 4 - Dynamic random-access memory - wikt:deassert, wikt:deasserted, wikt:deasserted: seems to be technical term, found in other sources
- 1 - Dynamic tonality - wikt:ranats: instrument, wikilinked it to its article
- 1 - Dynamic window manager - wikt:spectrwm: name of a window manager program
- 1 - Dzhetyasar culture - wikt:necropolices: not sure what language, source is in Russian
- 1 - Dioscorea communis - wikt:dimethoxy-7,8-methylenedioxyphenanthrene - chemical notation
Case notes (E) for 2020-08-20 dump
[edit]T1+
[edit]- 5 - ESL One Cologne 2016 - wikt:cajunb, wikt:cajunb, wikt:sezied, wikt:spaze, wikt:spaze: nicknames. Ira Leviton (talk) 18:43, 13 September 2020 (UTC)
- 3 - ESL Pro League Season 5 - wikt:devoduvek, wikt:ropz, wikt:ropz: user names in this game. Ira Leviton (talk) 18:43, 13 September 2020 (UTC)
- 3 - East Ambae language - wikt:cliticised, wikt:tangaloi, wikt:iaring: a linguistic term and two words from the language. CateFromArcadia (talk) 18:31, 11 September 2020 (UTC)
- 1 - Eastern Pomo language - wikt:commitation: unclear if it's supposed to be commutation. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 2 - Ecclesiastical jurisdiction - wikt:annexal: legit word. Ira Leviton (talk) 20:25, 17 September 2020 (UTC)
- 3 - Echinaster - wikt:perihaemal: a biological term. CateFromArcadia (talk) 19:10, 13 September 2020 (UTC)
- 6 - Echinoderm - wikt:perihaemal, wikt:perihaemal, wikt:perihaemal, wikt:perihaemal, wikt:perihaemal, wikt:susuhan: biological terms. CateFromArcadia (talk) 19:10, 13 September 2020 (UTC) // I think susuhan is part of a species name, but I'm not sure enough of how they're formatted - the article gives Thelenota ananas (susuhan) --Xurizuri (talk) 09:12, 31 January 2021 (UTC)
- 7 - Echis carinatus - wikt:phissi, wikt:pamboo, wikt:surutai, wikt:vireyan, wikt:janndi, wikt:padkoo, wikt:udaneyn: local names for this snake. Ira Leviton (talk) 20:25, 17 September 2020 (UTC)
- 2 - Ectoderm specification - wikt:desuppression: biology term. Ira Leviton (talk) 20:25, 17 September 2020 (UTC)
- 1 - Edinoverie - wikt:coreligionism - a literal translation of the page's title. CateFromArcadia (talk) 19:08, 16 September 2020 (UTC)
- 2 - Edward von Lõngus - wikt:R)estart, wikt:estart: part of the name of a song. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
- 12 - Efficient approximately-fair item allocation - wikt:O(poly, wikt:p(Xi), wikt:p(Xi), wikt:p(Xj), wikt:p(Xi), wikt:p(Xi), wikt:p(Xi), wikt:p(Xi), wikt:O(poly, wikt:ln(Vmax), wikt:Vi(o), wikt:e)Vi: mathematical formulas. Ira Leviton (talk) 22:44, 18 September 2020 (UTC)
- 1 - Egalitarian equivalence - wikt:min(x: part of a mathematical notation. Ira Leviton (talk) 02:23, 25 September 2020 (UTC)
- 4 - Eggja stone - wikt:a(i, wikt:a)u, wikt:lagi(s), wikt:harie: runic inscriptions, copied in the article. Ira Leviton (talk) 02:23, 25 September 2020 (UTC)
- 2 - Egilina mariella - (OK: wikt:subnodulose): seems legit. Ira Leviton (talk) 02:23, 25 September 2020 (UTC)
- 1 - Egor Kuroptev - wikt:deoccupation: seems legit. Ira Leviton (talk) 02:23, 25 September 2020 (UTC)
- 9 - Ekphrasis - wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness, wikt:bedness: a concept introduced by Plato. (It hasn't caught on.) Ira Leviton (talk) 21:17, 18 September 2020 (UTC)
- 1 - Electoral system of Turkey - wikt:beldes: Seems to be the correct plural of the Turkish word 'belde'. CateFromArcadia (talk) 16:53, 19 September 2020 (UTC)
- 2 - Electric vehicle network - wikt:eflott, wikt:eflott: the name of an electric vehicle project, apparently written all lower case. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 2 - Electron paramagnetic resonance - wikt:gzz: part of mathematical notation. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 11 - Electronic skin - wikt:poly(N, wikt:di(thiophen, c]pyrrole, wikt:rehealable, wikt:rehealable, wikt:rehealable, wikt:rehealable: parts of chemical names, and rehealable is mentioned in a reference, so it's legit. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 1 - Electrostatic loudspeaker - wikt:treVolo: a product name. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 3 - Elektrozavodskaya (Moscow Metro) - wikt:salietti, wikt:duvalu, wikt:salietti: types of marble (stone), I'm not sure if they should be capitalized. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 2 - Elena and the Secret of Avalor - wikt:sambarossa, wikt:sambarossa: a type of dance, maybe an in-universe term for this story. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 1 - Elizabeth Hand - wikt:aardmen: an in-universe term from one of her books. Ira Leviton (talk) 20:37, 28 September 2020 (UTC)
- 13 - Elizabeth Rogers' Virginal Book - wikt:Symphon(ies), wikt:Symphon(ies), wikt:Alm(aygne), wikt:Alma(ygne), wikt:enioyes, wikt:aygne, wikt:ygne, wikt:ffoote, wikt:comne, wikt:spaynard, wikt:ffinex, wikt:flattring, wikt:preethe: words in titles of musical pieces. Ira Leviton (talk) 20:37, 28 September 2020 (UTC)
- Email sender accreditation - wikt:accreditee - accreditee
- Emancipation reform of 1861 - wikt:province(s), wikt:skhod, wikt:skhod, wikt:batraks - the mir assembly, the skhod (sel'skii skhod), Batrak
- Emani Sankara Sastry - wikt:vinyas - Brmara vinyas – a thematic composition
- Emberger syndrome - wikt:A(GATA) - nucleic acid sequence viz., (T/A(GATA)A/G)
- Emblem of Kazakhstan - wikt:uyks - uyks (supports)
- Emblem of the West - wikt:imnt, wikt:wnmy - hieroglyph represents imnt "west" or wnmy "right".
- Embroidery of India - wikt:bakhia, wikt:bakhia, wikt:bakhia, wikt:khatava, wikt:sozni, wikt:gokru, wikt:chogas, wikt:phatuhi, wikt:pugur, wikt:mettvi, wikt:mukais - all ok
- Emic and etic - wikt:etics - plural of title term
- Emma Palladino - wikt:twelle - Le due twelle
- Empire of Man - wikt:scummies - referred to as Mardukans (or unofficially, scummies)
- Employee Stock Ownership Plan - wikt:k)s - 401(k)s
- Employment contract in English law - wikt:collag, wikt:collag, wikt:collag, wikt:collag - unclear
- En (deity) - wikt:a(t) - from Proto-Albanian *dźie̅u ̊ *a(t)t (a cognate of PIE *Dyḗus ph₂tḗr)
- 1 - Encantadia - wikt:encant(ad): showing a word derivation. Ira Leviton (talk) 20:28, 24 September 2020 (UTC)
- Encarna Sant-Celoni i Verger - wikt:cassidas - unclear
- 4 - Enchanted Garden - wikt:salangkay, wikt:salangkay, wikt:salangkay, wikt:salangkay: an in-universe term in this story. Ira Leviton (talk) 20:28, 24 September 2020 (UTC)
- 1 - Endebjerg - wikt:flotated: an archaeological term. CateFromArcadia (talk) 18:29, 23 September 2020 (UTC)
- Endill - wikt:ndils - [Æ]ndils iarmungrundaR which is a kenning for the sea.
- 1 - Enga language - wikt:locationals: a legit word (plural). Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 9 - England runestones - wikt:iut(l), wikt:u(a), wikt:s(u), wikt:a)u, wikt:tuknuts, wikt:skulti, wikt:ialbi, wikt:siaul, wikt:luntunum: inscriptions on stones. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 3 - English contract law - wikt:offerree, wikt:misrepresentee, wikt:misrepresentee: legal jargon. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 1 - English in New Mexico - wikt:ombers: regional English. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 2 - English orthography - wikt:pattern(s), wikt:oux: showing both singular and plural, and a word ending. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 1 - English terms with diacritical marks - wikt:drowle: showing a pronunciation. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 4 - English verbs - e]s, e]s, wikt:combat(t): showing word suffixes and spellings. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 5 - English-language spelling reform - wikt:in)definite, wikt:in)definit: showing two words. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 1 - Enischnomyia - wikt:steblid: an adjective applicable to flies. Ira Leviton (talk) 23:08, 28 September 2020 (UTC)
- 1 - Epaphroditus - wikt:praefecture: an acceptable spelling. Ira Leviton (talk) 19:32, 28 September 2020 (UTC)
- 3 - Epenthesis - wikt:somepthing, wikt:ambrotos, wikt:homre: spelled deliberately to show pronunciation. Ira Leviton (talk) 19:32, 28 September 2020 (UTC)
- 2 - Epitranscriptomic sequencing - P]NTPs, P]ATP: molecular biology notation. Ira Leviton (talk) 19:32, 28 September 2020 (UTC)
- 1 - Epoxydocosapentaenoic acid - wikt:y(S): part of a long chemical name. Ira Leviton (talk) 19:32, 28 September 2020 (UTC)
- 1 - Eqn (software) - wikt:neqn: the name of a software program. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Equating coefficients - wikt:x(x: part of a mathematical formula. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 1 - Equatorial spitting cobra - wikt:toxinological: a legit word. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Equilibrium chemistry - wikt:TA(i), wikt:TB(i): parts of mathematical formulas. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Equilibrium constant - K[ML]: part of a mathematical formula. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Equivalence of metrics - wikt:renormed: mathematical jargon. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Eremophila mitchellii - wikt:budtha, wikt:balvory: local names for this plant. Ira Leviton (talk) 01:11, 29 September 2020 (UTC) // no indication in the article what language these are from, and the reference is a book so I can't check. I also think these have been adopted into English, based on the way websites are using the terms. --Xurizuri (talk) 08:30, 1 February 2021 (UTC)
- 7 - Erfworld - wikt:spidews, wikt:twolls, wikt:uncroaked, wikt:uncroak, wikt:arkentool, wikt:uncroaking, wikt:uncroaked: all in-universe terms in this story. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 1 - Ergine - wikt:cloA: the name of an enzyme. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 7 - Ergoline - wikt:beta(S), wikt:beta(S), wikt:alpha(S), wikt:alpha(S), wikt:clavines, wikt:clavines, wikt:clavines: parts of chemical names and a group of chemicals. Ira Leviton (talk) 01:11, 29 September 2020 (UTC)
- 2 - Erishum I - wikt:u(m): showing another spelling. Ira Leviton (talk) 01:53, 29 September 2020 (UTC)
- 1 - Erythrogenic toxin - wikt:speJ: the name of a gene. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 2 - Escherichia virus T4 - wikt:uvsX: the name of a gene. Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 1 - Eschmeyer nexus - wikt:cofishes: local name for a fish (plural). Ira Leviton (talk) 19:35, 25 September 2020 (UTC)
- 5 - Essen Minster - wikt:I)DA, wikt:Y(ear), wikt:O(ur: from inscriptions on stones. Ira Leviton (talk) 01:15, 26 September 2020 (UTC)
- 5 - Estimation of distribution algorithm - wikt:M(t), wikt:M(t, wikt:model(P, wikt:M(t), wikt:thresheld: parts of mathematical formulas and an arcane mathematical term - in a citation. Ira Leviton (talk) 15:10, 26 September 2020 (UTC) // More accurately, it's an algorithm. Not sure if it should be treated like code, maths, or something else. --Xurizuri (talk) 09:12, 31 January 2021 (UTC)
- 1 - Etang Saumâtre - wikt:caguey: a local name for a plant. Ira Leviton (talk) 22:33, 26 September 2020 (UTC)
- 3 - Eternal Champion (character) - wikt:ordor, wikt:howeve, wikt:exalogy: seems to be a word. Ira Leviton (talk) 22:33, 26 September 2020 (UTC)
- 2 - Ethernut - wikt:egnite, wikt:proconX: both are company names, lower case. Ira Leviton (talk) 22:33, 26 September 2020 (UTC)
- 1 - Etruscan language - wikt:piratesque: unclear. Ira Leviton (talk) 22:33, 26 September 2020 (UTC) // added the clarify template. hopefully someone fixes it --Xurizuri (talk) 09:12, 31 January 2021 (UTC)
- 1 - Etruscan society - wikt:gamonymic: named after a husband, i.e., Susan wife of John. Analogous to patronymic, matronymic. Ira Leviton (talk)
- 1 - Etymology of Skye - wikt:suffigation: a linguistic term that means adding a suffix. Ira Leviton (talk) 22:33, 26 September 2020 (UTC) // an alt spelling of wikt:suffixation which is on there already. Should make it easy to do (this spelling has been used in a few sources so should be good for wikt). --Xurizuri (talk) 09:12, 31 January 2021 (UTC)
- 3 - Eu'Vend - wikt:coffeena, wikt:coffeena, wikt:coffeena: the name of a coffee celebration in Europe, correct lower case. Ira Leviton (talk) 22:33, 26 September 2020 (UTC)
- 1 - Eudaf Hen - wikt:Out(h): showing an alternative or uncertain spelling of an old Welsh word. Ira Leviton (talk) 16:24, 26 September 2020 (UTC)
- 1 - Eugraphe - wikt:noctuine: a type of moth. Ira Leviton (talk) 17:52, 29 September 2020 (UTC)
- 2 - Euhoplites - wikt:lautiform, wikt:lautiform: lautiform is an arcane but legit word. Ira Leviton (talk) 17:52, 29 September 2020 (UTC)
- 1 - Euphorbia tithymaloides - wikt:euphorbol: a chemical name. Ira Leviton (talk) 17:52, 29 September 2020 (UTC)
- 13 - European rabbit - wikt:rabbidge, wikt:rabbert, wikt:rabbette, wikt:rabytt, wikt:coniz, wikt:wareine, wikt:warenna, wikt:conniniere, wikt:coninyere, wikt:conilliere, wikt:kiniklos: various other languages words, some modern and some dead. --Xurizuri (talk) 09:12, 31 January 2021 (UTC)
- 1 - European sprat - wikt:russlet: another common name for this fish. Ira Leviton (talk) 17:52, 29 September 2020 (UTC)
- 1 - Euxinia - wikt:paleogeologists: a legit word (plural). Ira Leviton (talk) 14:28, 26 September 2020 (UTC)
- 3 - Everyday Aesthetics - wikt:artification, wikt:artificating, wikt:artificating: jargon in the field of aesthetics. Ira Leviton (talk) 01:53, 29 September 2020 (UTC)
- 2 - Evolution of cephalopods - wikt:coeloids, wikt:coeloids: A type of cephalopod. CateFromArcadia (talk) 11:51, 26 September 2020 (UTC)
- 7 - Evolutionary history of plants - wikt:telome, wikt:telome, wikt:telome, wikt:telome, wikt:planated, wikt:telome, wikt:gymnospermic: Biological terms. CateFromArcadia (talk) 11:51, 26 September 2020 (UTC)
- 6 - Exec (system call) - wikt:execlp, wikt:envp, wikt:envp, wikt:envp, wikt:envp, wikt:execlp: Names of functions. CateFromArcadia (talk) 11:51, 26 September 2020 (UTC)
- 3 - Expedition of Dramali - wikt:delhis, wikt:delhis, wikt:delhis: unclear. Ira Leviton (talk) 23:33, 27 September 2020 (UTC)
- 1 - Explained sum of squares - wikt:xji: a mathematical notation. Ira Leviton (talk) 23:33, 27 September 2020 (UTC)
- 3 - Exposition Universelle (1900) - wikt:edicules, wikt:edicules, wikt:edicules: a legit word (plural). Ira Leviton (talk) 23:33, 27 September 2020 (UTC)
- 3 - Exsphere (polyhedra) - wikt:exspheres, wikt:exspheres, wikt:exspheres: a legit word, plural of the subject of the page. Ira Leviton (talk) 23:33, 27 September 2020 (UTC)
- 6 - Extended Window Manager Hints - wikt:aewm, wikt:bspwm, wikt:spectrwm, wikt:edewm, wikt:evilwm, wikt:interfacewm: all software programming jargon. Ira Leviton (talk) 23:33, 27 September 2020 (UTC)
TS+DOT+
[edit]- 1 - E.ventures - wikt:e.Venture: the name of a company. Ira Leviton (talk) 20:17, 18 September 2020 (UTC)
- 2 - ENCA - wikt:e.Sat, wikt:e.Sat: the name of a company. Ira Leviton (talk) 20:17, 18 September 2020 (UTC)
- 2 - EV7 The Sun Route - wikt:n.Vltavou, wikt:n.Vltavou: some type of Czech abbreviation, without a space after the period. Ira Leviton (talk) 20:17, 18 September 2020 (UTC)
- 1 - Ed Elliot - wikt:h.Art
- 1 - Electrospray ionization - nH]n: part of a chemistry notation. Ira Leviton (talk) 00:30, 20 September 2020 (UTC)
- 4 - Elves in fiction - wikt:miruvor, wikt:iynisin, wikt:unsingers, wikt:iynisin: in-universe terms. Ira Leviton (talk) 01:32, 20 September 2020 (UTC)
- 1 - Emanuel Pleitez - wikt:dot.LA: the name of an online news outlet in Los Angeles. Ira Leviton (talk)
- 3 - Eoarchean geology - wikt:protoplate, wikt:myloitic, wikt:metatonalites: Ira Leviton (talk) 21:02, 22 September 2020 (UTC)
- 1 - Epimorphosis - wikt:regenectin: the name of a protein. Ira Leviton (talk) 02:01, 23 September 2020 (UTC)
- 4 - Equative - wikt:boot(s), wikt:is(are), wikt:this.Neut, wikt:was.Masc: seem to be showing word constructions. Ira Leviton (talk) 02:01, 23 September 2020 (UTC)
- 1 - Ernie Toshack with the Australian cricket team in England in 1948 - wikt:ability.N: the N is part of a superscript to indicate there's a note at the end. Ira Leviton (talk) 19:49, 23 September 2020 (UTC)
- 1 - Et Fugit Intera Fugit Irreparabile Tempus - wikt:kl.K: a musician's stage name. Ira Leviton (talk) 02:04, 24 September 2020 (UTC)
- 1 - Eubac - wikt:eu.ESCO: the name of a company. Ira Leviton (talk) 02:04, 24 September 2020 (UTC)
- 1 - Evolution of insects - wikt:fusainized: a legit word. Ira Leviton (talk) 16:01, 24 September 2020 (UTC)
- 1 - Evolutionary fauna - wikt:coleolids: a legit word (plural). Ira Leviton (talk) 16:01, 24 September 2020 (UTC)
- 1 - Exact differential equation - wikt:F(x: part of a mathematical formula. Ira Leviton (talk) 19:12, 24 September 2020 (UTC)
- 2 - Excision (musician) - wikt:ill.Gates, wikt:ill.Gates: a musical artist's name. Ira Leviton (talk) 19:12, 24 September 2020 (UTC)
- 2 - Exonic splicing silencer - wikt:TG)mT, wikt:TG)mT: a molecular biology abbreviation. Ira Leviton (talk) 19:12, 24 September 2020 (UTC)
- 4 - Extrachromosomal DNA - wikt:invertrons, wikt:invertron: legit (singular and plural), Ira Leviton (talk) 19:12, 24 September 2020 (UTC)
TS+COMMA+
[edit]- 49 - E6 (mathematics) - wikt:E6,ad, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:E6,sc, wikt:E6,ad, wikt:Aut(E, wikt:Gal(k), wikt:sc(q), wikt:ad(q), wikt:SL(n, wikt:PGL(n, wikt:PSL(n, wikt:sc(q), wikt:ad(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q, wikt:ad(q, wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:sc(q), wikt:ad(q), wikt:ad(q): parts of mathematical formulas. Ira Leviton (talk) 03:14, 13 September 2020 (UTC)
- 28 - E7 (mathematics) - wikt:E7,sc, wikt:E7,ad, wikt:E7,sc, wikt:E7,ad, wikt:E7,ad, wikt:E7,sc, wikt:E7,ad, wikt:E7,sc, wikt:E7,ad, wikt:E7,sc, wikt:E7,ad, wikt:E7,ad, wikt:Aut(E, wikt:sc(q), wikt:ad(q), wikt:SL(n, wikt:PGL(n, wikt:PSL(n, wikt:sc(q), wikt:ad(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:sc(q), wikt:ad(q), wikt:ad(q): parts of mathematical formulas. Ira Leviton (talk) 03:14, 13 September 2020 (UTC)
- 1 - Early modern glass in England - wikt:rochetta: a type of plant. Ira Leviton (talk) 20:07, 12 September 2020 (UTC)
- 2 - Earth mover's distance - wikt:x1,m1, wikt:xn,mn: mathematical formulas. Ira Leviton (talk) 20:07, 12 September 2020 (UTC)
- 3 - Edwards curve - wikt:x1,y1, wikt:x2,y2, wikt:x3,y3: parts of mathematical formulas. Ira Leviton (talk) 16:12, 13 September 2020 (UTC)
- 5 - Egorov's theorem - wikt:A0,m0, wikt:A1,m1, wikt:d(f, wikt:fm(x), wikt:fm(x): parts of mathematical formulas. Ira Leviton (talk) 16:12, 13 September 2020 (UTC)
- 1 - Ekplexite - wikt:fenitic, wikt:kaskasite: geology terms. Ira Leviton (talk) 16:12, 13 September 2020 (UTC)
- 3 - Elastin-like polypeptides - wikt:ΔTt,fusion, wikt:ΔTt,fusion, wikt:VPGXG)n: parts of mathematical formulas. Ira Leviton (talk) 16:12, 13 September 2020 (UTC)
- 1 - Electrocyclic reaction - wikt:cis,trans: part of a chemical formula. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 6 - Electron scattering - wikt:q1,q2, wikt:electron(s), wikt:electron(s), wikt:accelerator(s), wikt:ring(s): done deliberately to show singular and plural. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 8 - Electronic band structure - wikt:b1,b2, wikt:m1,m2, wikt:En(k), wikt:En(k), wikt:g(E), wikt:g(E), wikt:g(E), wikt:V(r): parts of mathematical formulas. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 1 - Ellipsis (linguistics) - wikt:Monday,she: showing a linguistic form, without a space. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 1 - Elliptical distribution - wikt:x1,x2: mathematical formula. Ira Leviton (talk) 21:51, 13 September 2020 (UTC)
- 3 - English plurals - wikt:e)n, wikt:ax(e), wikt:apple(s): showing English grammar. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 1 - Enterobactin - wikt:Kf,Fe3: part of a mathematical formula. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 1 - Enterprise Architect (software) - wikt:of .emx: a software file suffix. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 22 - Envelope (mathematics) - wikt:x0,y0, wikt:t0,t02, wikt:ft(x, wikt:F(t, wikt:ft(x, wikt:F(t, wikt:F(t, wikt:F(t, wikt:u(x, wikt:y)cos, wikt:v(x, wikt:y)sin, wikt:w(x, wikt:t)x, wikt:F(x, wikt:F(x, wikt:F(x, wikt:u(x, wikt:u(x, wikt:v(x), wikt:u(x, wikt:q(t): parts of mathematical formulas. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 3 - Equipartition theorem - wikt:qj,pj, wikt:U(r), wikt:M(r): mathematical formulas. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 1 - Equivalence number method - wikt:ηel,ref:mathematical formula. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 8 - Equivalence of categories - wikt:c1,c2, wikt:Fc1,Fc2, wikt:c1,c2, wikt:Fc1,Fc2, wikt:HomC(c, wikt:HomD(Fc, wikt:HomC(c, wikt:HomD(Fc: parts of mathematical formulas. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 26 - Equivalent definitions of mathematical structures - wikt:x1,x2, wikt:S(n), wikt:S(n), wikt:signature(s), wikt:P(X), wikt:P(P, wikt:P(P, wikt:P(A), wikt:P(N, wikt:P(N, wikt:P(N, wikt:P(N, wikt:P(X), wikt:P(P, wikt:P(P, wikt:P(P, wikt:f(x, wikt:f(x, wikt:P(X), wikt:f(A), wikt:P(P, wikt:P(P, wikt:F(f), wikt:P(SX), wikt:set(s), wikt:S(an): parts of mathematical formulas. Ira Leviton (talk) 00:36, 16 September 2020 (UTC)
- 1 - Erdős–Szekeres theorem - wikt:ai,bi: part of a mathematical formula. Ira Leviton (talk) 20:25, 17 September 2020 (UTC)
- 1 - Ettringite - wikt:hycarbonate: part of a chemical name. Ira Leviton (talk) 20:25, 17 September 2020 (UTC)
- 12 - Examples of vector spaces - wikt:Fn,Fm, wikt:T(ei), F[x], F[x], F[x], F[x], F[x, wikt:L(V, wikt:L(V, wikt:L(Fn, wikt:L(V, wikt:Fq)n: parts of mathematical notations. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
- 4 - Existentially closed model - wikt:xn,y1, wikt:xn,b1, wikt:xn,b1, wikt:an,b1: parts of mathematical notations. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
- 4 - Experix - wikt:backslash,slash, wikt:sin(j, wikt:c .sin: software instructions. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
- 9 - Exponential polynomial - wikt:xn,ex1, wikt:P(x, C[x, wikt:P(x, K[X], wikt:exp(wiX), wikt:exp(u, wikt:exp(u), wikt:exp(v): mathematical notations. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
- 20 - Exterior algebra - wikt:v1,v2, wikt:k(V), wikt:k(V), wikt:k(V), wikt:T(M), wikt:k(V), wikt:n(V), wikt:k(V), wikt:k(f), wikt:n(f), wikt:k(V), wikt:T(V), wikt:T(V), wikt:Tr(V), wikt:T(V), wikt:Alt(T, wikt:A(V), wikt:T(V), wikt:T(V), wikt:Grk(V): parts of mathematical notations. Ira Leviton (talk) 17:33, 18 September 2020 (UTC)
TS+EXTRA+
[edit]- 2 - ECPG - wikt:a .pgc, wikt:The .pcg: software file suffix. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 1 - EGG (file format) - wikt:placing .volX: software file suffix. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 1 - EPSXe - wikt:in .ppf: software file suffix. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 2 - EPUB - wikt:the .ncx, wikt:example .ncx: software file suffixes. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 1 - ESP - wikt:the .ESP, this is correct, name of a file format.
- 1 - EULUMDAT - wikt:is .ldt: software file suffix. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 2 - Edraw Max - wikt:The .edx, wikt:The .edxz: software file suffixes. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 1 - Electronic publishing - wikt:is .folio: software file suffix. Ira Leviton (talk) 15:03, 12 September 2020 (UTC)
- 3 - Endianness - wikt:MATLAB .mat, wikt:the .bil: software fil extensions.
- 2 - Engineered Software Inc. - wikt:extension .pipe, wikt:a .psv: software file extensions. Ira Leviton (talk) 16:15, 12 September 2020 (UTC)
- 1 - Esther Raab - wikt:ראב ,ילקוט: this is correct in Hebrew. Ira Leviton (talk) 16:15, 12 September 2020 (UTC)
- 1 - Extensible Metadata Platform - wikt:external .xmp: software file extension. Ira Leviton (talk) 16:15, 12 September 2020 (UTC)
Case notes (E) for 2020-02-20 dump
[edit]TS+COMMA+
[edit]- 5 - EbXML - wikt:bi,eks: showing a pronunciation. I'm not sure if it was done according to WP policy, though. Ira Leviton (talk) 19:06, 21 March 2020 (UTC)
- 1 - Ecdysone 20-monooxygenase - wikt:Ecdysone,hydrogen: part of an enzyme name, no space after the comma. Ira Leviton (talk) 19:06, 21 March 2020 (UTC)
- 2 - Ectoine - wikt:L-2,4-diaminobutyric, wikt:L-2,4-diaminobutyric: chemical name. Ira Leviton (talk) 19:06, 21 March 2020 (UTC)
- 1 - Elke (song) - wikt:you: in a song title. Ira Leviton (talk) 16:07, 23 March 2020 (UTC)
- 2 - Endomicroscopy - wikt:µm, wikt:toumous - don't know how to fix the first one, and second might be okay Strickesel (talk) - perhaps spell out "micrometers"? Carla.Abra (talk)
- 1 - Enhanced vegetation index - wikt:red,NIR - computational science notation Strickesel (talk)
- 2 - Enoyl-(acyl-carrier-protein) reductase (NADPH, A-specific) - wikt:trans-2,3-dehydroacyl, wikt:trans-2,3-dehydroacyl - chemistry notation Strickesel (talk)
- 2 - Enoyl-(acyl-carrier-protein) reductase (NADPH, B-specific) - wikt:trans-2,3-dehydroacyl, wikt:trans-2,3-dehydroacyl - chemistry notation Strickesel (talk)
- 1 - Ent-cassa-12,15-diene 11-hydroxylase - wikt:ent-11beta-hydroxycassa-12,15-diene - chemistry notation Strickesel (talk)
- 14 - EnvZ/OmpR two-component system - wikt:ompC, wikt:ompF, wikt:ompF, wikt:ompC, wikt:ompF, wikt:ompC, wikt:ompF, wikt:ompC, wikt:ompC, wikt:ompF, wikt:ompF, wikt:ompF, wikt:ompC, wikt:ompF - all some kind of chemical notation Strickesel (talk)
- 3 - Epistolary novel - wikt:13¾, wikt:373⁄4 - part of book titles Strickesel (talk)
- 4 - Ethernet Ring Protection Switching - wikt:NR,RB, wikt:APS(SF, wikt:APS(NR, wikt:APS(NR - computational science notations Strickesel (talk)
- 1 - Ethylmethylthiambutene - wikt:N-ethyl-N-methyl-1-methyl-3,3-di-2-thienylallylamine - chemistry notation
- 1 - Eucalyptus microtheca - wikt:globulol - chemistry term Strickesel (talk)
- 1 - Every Man in His Humour - wikt:IV,iv - i think it's correct like that Strickesel (talk)
- 1 - Every Man out of His Humour - wikt:III,ii - i think it's correct like that Strickesel (talk)
TS+BRACKET+
[edit]- 1 - E2F1 - promoter[PAX8 - chemistry notation Strickesel (talk)
- 3 - E8 (mathematics) - wikt:Spin(16, wikt:so(16, wikt:spin(16 - mathematical notation Strickesel (talk)
- 1 - ECL (data-centric programming language) - wikt:OUTPUT(SD - computational science notation Strickesel (talk)
- 1 - ECU'92 - wikt:in)directly - probably correct Strickesel (talk)
- 1 - EDePro - wikt:R60M(MK - part of a name Strickesel (talk)
- 1 - EF50 - wikt:PO)VT - part of a name Strickesel (talk)
- 1 - EFCBP2 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 2 - EGLN1 - wikt:iron(II, wikt:iron(II - chemistry notation Strickesel (talk)
- 1 - EHA101 - wikt:A136(pTiBo542 - chemistry notation Strickesel (talk)
- 1 - EHNA - wikt:nonyl)adenine - chemistry notation Strickesel (talk)
- 1 - EIF2C1 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 1 - EIF4E3 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 1 - ELAM 5 Combate Ceja del Negro - wikt:studies(prep
- 1 - ENC1 - wikt:tm1a(EUCOMM - chemistry notation Strickesel (talk)
- 2 - ENDOG - wikt:poly(dG, wikt:poly(dC - chemistry notation Strickesel (talk)
- 1 - ENO3 - wikt:rich)6GG - chemistry (?) notation Strickesel (talk)
- 1 - ENTPD6 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 2 - EPA list of extremely hazardous substances - wikt:yl)Methylene, wikt:Decaborane(14 - chemistry notation Strickesel (talk)
- 1 - EPS15 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 3 - ERCC5 - wikt:Ercc5(Xpg, wikt:Ercc5(Xpg, wikt:Ercc5(Xpg - chemistry notation Strickesel (talk)
- 4 - ERCC6 - wikt:CSA(ERCC8, wikt:CSB(ERCC6, wikt:CSB(ERCC6, wikt:SNM1A(DCLRE1A - chemistry notation Strickesel (talk)
- 2 - ERCC8 (gene) - wikt:CSA(ERCC8, wikt:CSB(ERCC6 - chemistry notation Strickesel (talk)
- 1 - ERLIN2 - wikt:tm1a(EUCOMM - chemistry notation Strickesel (talk)
- 1 - ESA CAVES - wikt:cavenauts - apparently a real word Strickesel (talk)
- 1 - ETFE - wikt:poly(ethene - chemistry notation Strickesel (talk)
- 1 - EVI5 - wikt:tm1a(KOMP - chemistry notation Strickesel (talk)
- 1 - EXOC3L2 - wikt:tm1b(KOMP - chemistry notation Strickesel (talk)
- 1 - Earl of Devon - wikt:Devon(iae: written deliberately, Latin. Ira Leviton (talk) 23:05, 28 March 2020 (UTC)
- 2 - Earthtone9 - wikt:def(inition: part of the name of a record album. Ira Leviton (talk) 23:05, 28 March 2020 (UTC)
- 4 - East Bengal State Acquisition and Tenancy Act of 1950 - wikt:rajasva, wikt:rajasva, wikt:rajasva, wikt:rajasva, wikt:rajasva: I tagged the first instance with the 'which lang' tag. Ira Leviton (talk) 17:00, 27 March 2020 (UTC)
- 8 - East Strickland languages - wikt:da)subu, wikt:mere(ma, wikt:da)suf, wikt:fulu(ma (probably OK: wikt:pTNG, wikt:maŋgat, wikt:korofu, wikt:ŋg): all trying to show transcribed words. Ira Leviton (talk) 17:00, 27 March 2020 (UTC)
- 1 - Eastern Slovak Hills - wikt:East(ern: written deliberately. Ira Leviton (talk) 17:00, 27 March 2020 (UTC) // this would be fine elsewhere in text, but I'm not sure if we're allowed to do that in the bolded part of the first sentence. --Xurizuri (talk) 10:01, 31 January 2021 (UTC)
- 1 - Eastern Sudanic languages - wikt:ko)TVS: trying to show some type of foreign word. Ira Leviton (talk) 17:00, 27 March 2020 (UTC)
- 2 - Eastern Trans-Fly languages - wikt:ka)mu, wikt:ka)mi, wikt:you: showing language. Ira Leviton (talk) 23:05, 28 March 2020 (UTC)
- 1 - Ecological art - wikt:Environ)Mental: part of the name of an artwork. Ira Leviton (talk) 17:45, 28 March 2020 (UTC)
- 4 - Edfor - wikt:ED)uardo, wikt:OR)ge, wikt:uardo: all explaining word origins. Ira Leviton (talk) 18:54, 28 March 2020 (UTC)
- 1 - Edge recombination operator - wikt:length(Parent: software jargon. Ira Leviton (talk) 18:54, 28 March 2020 (UTC)
- 2 - Edith Humphrey - wikt:dinitrocobalt(III: chemistry notation. Ira Leviton (talk) 18:54, 28 March 2020 (UTC)
- 1 - Edmonds–Karp algorithm - graph[cur: part of software code. Ira Leviton (talk) 18:54, 28 March 2020 (UTC)
- 1 - Edward I. Solomon - wikt:Hydroxy)mandelate: part of a chemical name. Ira Leviton (talk) 00:29, 30 March 2020 (UTC)
- 1 - Edward J. Bloustein School of Planning and Public Policy - wikt:geoprocessioning: looks legit. Ira Leviton (talk) 00:29, 30 March 2020 (UTC)
- 1 - Elassovalene - cyclopent[cd: part of a chemical name. Ira Leviton (talk) 21:14, 31 March 2020 (UTC)
- 1 - Electroluminescence - wikt:Ru(bpy: chemistry notation. Ira Leviton (talk) 15:46, 3 April 2020 (UTC)
- 2 - Electron beam-induced deposition - wikt:Me(CO: chemistry notation. Ira Leviton (talk) 15:46, 3 April 2020 (UTC)
- 2 - Electron-transferring-flavoprotein dehydrogenase - wikt:QO(red, wikt:QO(ox: chemistry notation. Ira Leviton (talk) 15:46, 3 April 2020 (UTC)
- 2 - Electronic Saviors: Industrial Music To Cure Cancer - Rein[Forced, Rein[Forced: the name of an album.
- 1 - Elias Arnér - wikt:In)Visible: the name of an artwork. Ira Leviton (talk) 22:01, 3 April 2020 (UTC)
- 1 - Eliashib (High Priest) - wikt:grand)father: written deliberately. Ira Leviton (talk) 22:01, 3 April 2020 (UTC)
- 1 - Elizabeth (1809 Bristol ship) - wikt:Ne(illegible: written deliberately. Ira Leviton (talk) 22:01, 3 April 2020 (UTC)
- 1 - Elizabeth Morton - wikt:Five(ish: part of the name of a TV program.Ira Leviton (talk) 22:01, 3 April 2020 (UTC)
- 1 - Elizabeth de Portzamparc - wikt:Re)Construire: the name of a project. Ira Leviton (talk) 22:01, 3 April 2020 (UTC)
- Elnathan John - wikt:Be(com - Be(com)ing Nigerian, book title
- Emanuel syndrome - wikt:der(22, wikt:der(22, wikt:der(22, wikt:der(22, wikt:der(22, wikt:der(22 - derivative 22 syndrome, or der(22) syndrome // it's an alt name for the article, so a redirect is probably the best fix (will that fix this or do the parentheses mess it up?). --Xurizuri (talk) 10:01, 31 January 2021 (UTC)
- 1 - Emma L. E. Rees - wikt:Dis)ease - (Dis)ease, part of a book chapter title
- 1 - Enconcept E-Academy - wikt:memolodies: a made-up word. Ira Leviton (talk) 17:59, 4 April 2020 (UTC)
- 3 - Endo-alpha-sialidase - wikt:poly(alpha, wikt:poly(alpha, wikt:poly(sialic: chemistry notations. Ira Leviton (talk) 17:59, 4 April 2020 (UTC)
- 1 - Endomorphin-2 - Met]enkephalin: chemistry notation. Ira Leviton (talk) 17:59, 4 April 2020 (UTC)
- 6 - Endoscopic endonasal surgery - wikt:transplanum, wikt:subchiasmatic: medical/anatomic jargon. Ira Leviton (talk) 17:59, 4 April 2020 (UTC)
- 2 - Endothion - wikt:YL)METHYL, wikt:YL)METHYL: chemistry jargon. Ira Leviton (talk) 17:59, 4 April 2020 (UTC)
- 1 - Engelhardt family - wikt:stolniks - a real word Strickesel (talk)
- 1 - Enigmata - wikt:hexa)metrical - probably correct Strickesel (talk)
- 1 - Enol - wikt:RC(OH - chemistry notation Strickesel (talk)
- 1 - Enriques surface - wikt:super)singular - probably correct Strickesel (talk)
- 1 - Environmentally-friendly red light flare - wikt:poly(vinyl - chemistry notation Strickesel (talk)
- 1 - Eousdryosaurus - wikt:SHN(JJS - part of a name Strickesel (talk)
- 1 - Ephrin A1 - wikt:tm1a(EUCOMM - chemistry notation Strickesel (talk)
- 1 - Epps - piperazinyl]propanesulfonic - chemistry notation Strickesel (talk)
- 1 - Epristeride - wikt:butylcarbamoyl)androsta - chemistry notation Strickesel (talk)
- 1 - Equicontinuity - wikt:arctan(nx - mathematical notation Strickesel (talk)
- 1 - Equizetum - wikt:Equizeten(sis - latin Strickesel (talk)
- 2 - Erechtheis - Ph[ryni, Ph[ryni - two versions of a greek name Strickesel (talk)
- 2 - Eric Chasalow - wikt:Cinta)mani, wikt:Cinta)mani - part of a title Strickesel (talk)
- 1 - Ericssonite - FeO[Si - chemistry notation Strickesel (talk)
- 2 - Erika Rothenberg - wikt:Un)Fame, wikt:Un(Fame - title Strickesel (talk)
- 2 - Eritrean Catholic Archeparchy of Asmara - wikt:Asmaren(sis, wikt:Asmaren(sis - latin Strickesel (talk)
- 2 - Ermenek - wikt:Basil(eus, wikt:Germanicopolitan(us - latin names Strickesel (talk)
- 1 - Erondu–Cymet syndrome - wikt:inv(21 - probably correct Strickesel (talk)
- 2 - Erythrosine - spiro[3H, Spiro[isobenzofuran - chemistry notation Strickesel (talk)
- 1 - Erythrum - wikt:Erythritan(us - Latin word Strickesel (talk)
- 1 - Essays in French Literature and Culture - wikt:Re)sist - part of a title Strickesel (talk)
- 2 - Ester - wikt:RC(OR, wikt:Poly(ethylene - chemistry notationStrickesel (talk)
- 1 - Estriol succinate - wikt:di(hydrogen - chemistry notation Strickesel (talk)
- 1 - Eteplirsen - CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG - probably correct chemistry notation Strickesel (talk)
- 2 - Ethanethiol - wikt:Hg(SEt, wikt:Ni(SEt - chemistry notation Strickesel (talk)
- 1 - Ethenolysis - wikt:Rhenium(VII - chemistry notation Strickesel (talk)
- 1 - Ethyl cyanoacetate - wikt:cobalt(II - chemistry notation Strickesel (talk)
- 2 - Ethyl vinyl ether - wikt:EtOCH(OR, wikt:EtOC(Li - chemistry notation Strickesel (talk)
- 1 - Ethylenediaminediacetic acid - Na[Co - chemistry notation Strickesel (talk)
- 2 - Ethylisopropyltryptamine - wikt:yl)ethyl - chemistry notation Strickesel (talk)
- 1 - Ethylmercury - wikt:mercury(II - chemistry notation Strickesel (talk)
- 6 - EuFOD - wikt:Eu(fod, wikt:Eu(fod, wikt:Eu(fod, wikt:Eu(DPM, wikt:Eu(fod, wikt:Eu(fod - chemistry notation Strickesel (talk)
- 1 - Eudesmic acid - wikt:yl)benzamide - chemistry notation Strickesel (talk)
- 1 - Eugen Kölbing - wikt:German(ic - German(ic) Literature Strickesel (talk)
- 1 - Eugène-Melchior Péligot - wikt:chromium(II - chemistry notation Strickesel (talk)
- 1 - Euler pseudoprime - wikt:if(modPow - computational science notation Strickesel (talk)
- 1 - European League of Institutes of the Arts - wikt:inter)national - (inter)national Strickesel (talk)
- 1 - European Technology Exposure Facility - wikt:Flux(Phi - part of a name Strickesel (talk)
- 1 - Europium(III) chloride - wikt:LiN(SiMe - chemistry notation Strickesel (talk)
- 1 - Evangelical People's Party (Netherlands) - wikt:destalinised - seems correct Strickesel (talk)
- 2 - Evelyne Axell - wikt:homo)erotic, wikt:clartex - both seem correct Strickesel (talk)
- 1 - Evert Ploeg - wikt:inter)national - correct Strickesel (talk)
- 1 - Evo 2019 - Late[st - the name of a game Strickesel (talk)
- 2 - Evolution Championship Series - Late[st, Late[cl - names of Games Strickesel (talk)
- 1 - Evolution and the Catholic Church - wikt:evolution(ism - correct Strickesel (talk)
- 1 - Evolutionary epistemology - wikt:onto)genetic - correct Strickesel (talk)
- 1 - Exact (company) - My[Firm - My[Firm], apparently the name of a tool Strickesel (talk)
- 1 - Exiliboa - [[wikt:B1ab(iii] - a name Strickesel (talk)
- 1 - Exo Planet 3 – The Exo'rdium (dot) - rDIUM[dot - stylized version of this album name Strickesel (talk)
- 1 - Exotic hadron - wikt:Zc(3900 - name of a Hadron candidate Strickesel (talk)
- 3 - Exp algebra - wikt:exp(gt, wikt:exp(gt, wikt:exp(gt - mathematical notation Strickesel (talk)
- 2 - Expected value of including uncertainty - wikt:LogNormal(median, wikt:LogNormal(median - computational science notation Strickesel (talk)
- 3 - Expectiminimax - wikt:expectiminimax(child, Probability[child, wikt:expectiminimax(child - computational science notation Strickesel (talk)
- 4 - Expert system - wikt:Man(Socrates, wikt:Mortal(Socrates, wikt:Mortal(Socrates, wikt:Man(Socrates - computational science notation Strickesel (talk)
- 3 - Extensions to the International Phonetic Alphabet - wikt:de)voiced, wikt:de)voicing, wikt:denasals - all correct Strickesel (talk)
- 1 - Exterior (topology) - wikt:ext(ext - mathematical notation Strickesel (talk)
- 1 - Extra(ordinary) People - wikt:Extra(ordinary - Extra(ordinary), part of the title Strickesel (talk)
- 1 - Eye2eye Software - inter]national - written intentionally as [inter]national Strickesel (talk)
- 1 - Ezzedine Salim - wikt:Ali(as - probably intended to be written as Ali(as) Strickesel (talk)
TS+EXTRA+
[edit]- 1 - Eichler–Shimura isomorphism - wikt:c ,M - mathematical notation Strickesel (talk)
- 1 - EigenMoments - wikt:signal ,i - mathematical notation Strickesel (talk)
- 2 - Eric Charles Milner - wikt:ω ,3, wikt:ω ,k - mathematical notations Strickesel (talk)
T2+
[edit]E.-Edo
[edit]- 1 - E.G. Crazy - wikt:digifest - apparently a real word Strickesel (talk)
- 1 - E.I.S. Men's Volleyball - wikt:trokos - according to the article some kind of prank Strickesel (talk)
- 2 - ERuby - wikt:erubis, wikt:erubis (OK - name of a program)
- 1 - ETwinning - wikt:eTwinners - teachers that participate in "ETwinning" Strickesel (talk)
- 2 - Ecogovernmentality - wikt:environmentality, wikt:environmentality - a synonym of the title of the page Strickesel (talk)
- 1 - Econocom - wikt:altabox - company name Strickesel (talk)
- 1 - Econocracy - wikt:econocrat - "an expert on the economy" Strickesel (talk)
- 1 - Economy of Algeria - wikt:sawnwood - seems to be a real word? Strickesel (talk)
- 1 - Economy of Nigeria - wikt:sawnwood - seems to be a real word? Strickesel (talk)
- 5 - Economyths - wikt:economyth: singular of the title of the page. Ira Leviton (talk) 23:16, 11 April 2020 (UTC)
- 3 - Ecopedagogy - wikt:planetarity, wikt:ecopedagogical, wikt:ecopedagogical - both seem correct Strickesel (talk)
- 1 - Ecovention - wikt:ecoventions - plural of the title page Strickesel (talk)
- 2 - Ecgfrith of Northumbria - wikt:here's - for "Wulfhere's" Ingratis (talk) 21:59, 26 April 2020 (UTC)
- 1 - Edith Rogers (Alberta politician) - wikt:it's - Credit's Strickesel (talk)
- 2 - Edith's checkerspot - wikt:tachnid - seems okay Strickesel (talk)
- 3 - Edmund Bacon (1785–1866) - wikt:nailry, wikt:nailry, wikt:nailry - apparently a "nail forge" Strickesel (talk)
- 1 - Edmund Clark - wikt:uncomposed - a real word Strickesel (talk)
- 1 - Edmund Tylney - wikt:friendshippe - in the title of a treatise Strickesel (talk)
- 1 - Edoheart - wikt:he's - Enohe's Strickesel (talk)
- 1 - Edouardo Jordan - wikt:salumists - salumist is someone who makes sausages Strickesel (talk)
Ei-Elg
[edit]- Ei mechanism - (probably OK: wikt:phenylsulfoxides) - unclear, "phenyl sulfoxide" has more Google results than "phenylsulfoxide"
- Eidyn - wikt:cinbin - cinbin (dogheads)
- Eilne - wikt:nEilne, wikt:nEilne - alias Mag nEilne
- Eimeriorina - wikt:homoxenous, wikt:homoxenous - medical term
- Ein Heller und ein Batzen - wikt:heido - under the name “Heidi, heido, heida” (based on the refrain)
- Einstein aether theory - wikt:aetheory - Einstein aether theory, also called aetheory
- Ekatarina Velika - (probably OK: wikt:bienalle) - capitalized Bienalle, not 100% sure
- Eko Eko Azarak - wikt:cabyolas - part of Eko Eko chant
- El Dorado, Arkansas - wikt:octunda - architectural term
- El Mamey Formation - wikt:dommeli - Sphaerodactylus dommeli / S. dommeli
- El Palmar CF - wikt:vinculation - Verb. vinculate. (rare) To tie or bind. (arithmetic) To calculate a vinculum.
- El puñao de rosas - wikt:culminative, wikt:tanguillo, wikt:chiquiya all OK
- El-Abry Museum for Heritage and Classic Cars - wikt:jusah - jusah (storage compartment for dates)
- Elachistosuchus - wikt:souchos - souchos, an Egyptian crocodile god
- Elai Lineendunge - wikt:hikwa - hikwa
- Elaine Nile - wikt:comptometrist - comptometrist
- Elaver - wikt:orvillei - Elaver orvillei (Chickering, 1937) — Panama
- Elbe Marshes - wikt:polderland - region of marsh or polderland
- Eldana - wikt:saccharrina, wikt:stemmator - African sugar-cane borer (Eldana saccharina); Xanthopimpla stemmator
- Elections in Bhutan - wikt:zomdu, wikt:kabneys - democratic election called a zomdu; kabneys
- Electric Picnic 2008 - wikt:myhabs (probably OK: wikt:myhab) - Myhab eco-friendly alternative to camping
- Electric Warrior (comics) - wikt:primmie - tribe of natural born natives called Primmies.
- Electron crystallography - wikt:undiffracted - OK
- Electronic Visualization Laboratory - wikt:augmentics - OK; (not OK: wikt:jonCates, should be Jon Cates)
- Electronic circuit - wikt:perfboards - perfboards
- Elegant pitta - wikt:hutzi - P. e. hutzi Meise, 1942 – island of Nusa Penida (southeast of Bali)
- Eleutherobia - wikt:imaharai (probably OK: wikt:vinadigitaria) - * Eleutherobia imaharai Bryce, Poliseno, Alderslade & Vargas, 2015
Es-Et
[edit]- 2 - Eskayan script - wikt:abidiha, wikt:simplit - names of characters in this script Strickesel (talk)
- 2 - Esoterica (medication) - wikt:steareth, wikt:steareth - chemistry term Strickesel (talk)
- 2 - Esquilache Riots - wikt:he's: inadvertent detection of "Esquilache's". Ira Leviton (talk) 00:39, 25 April 2020 (UTC)
- 1 - Esther de Jong - wikt:lunetes - part of a brand name Strickesel (talk)
- 1 - Estramustine phosphate - wikt:prostatin - seems correct Strickesel (talk)
- 1 - Estriol sulfate glucuronide - wikt:diconjugated - seems correct Strickesel (talk)
Euc-Eó
[edit]- 1 - Eucithara bascauda - wikt:fimbriolate - seems correct Strickesel (talk)
- 1 - Eucithara diaglypha - wikt:costulae - seems correct Strickesel (talk)
- 1 - Eucithara elegans - wikt:elevately - adj for elevate, might be okay Strickesel (talk)
- 2 - Eucithara lepidella - wikt:costulae, wikt:costulae - seems correct Strickesel (talk)
- 1 - Eucithara solida - wikt:granosely - might be okay? Strickesel (talk)
- 2 - Eufunction - wikt:eufunctions, wikt:eufunctions - plural of the title page name Strickesel (talk)
- 1 - Eulimella scillae - wikt:subangulated - a real word Strickesel (talk)
- 1 - Eumel - wikt:oimel - a pronounciaton "guide" Strickesel (talk)
- 1 - Euphalacra trifenestrata - wikt:postraedial - not correct, but don't know the correct spelling Strickesel (talk)
- 1 - European Business Aviation Association - wikt:aeropolitical - seems okay Strickesel (talk)
- 2 - European hornet - wikt:vespines, wikt:vespines - latin name Strickesel (talk)
- 2 - Eurybia (plant) - wikt:scabrellous, wikt:epaleate - both are real words, it seems Strickesel (talk)
- 1 - Eurybotas - wikt:toxarch - not sure if okay Strickesel (talk)
- 3 - Eusebius Fermendžin - wikt:potssimum, wikt:eccelesiastica - latinStrickesel (talk)
- 1 - Euspira nitida - wikt:undeep - might be okay Strickesel (talk)
- 3 - Eustache le Peintre de Reims - wikt:he's, wikt:porroie, wikt:mestroie - Eustache's; french Strickesel (talk)
- 1 - Evan Rosen - wikt:collabicate - means "collaborate and communicate" Strickesel (talk)
- 1 - Evan Winiker - wikt:sirenXX - a musician/band Strickesel (talk)
- 1 - Evangelical Church of the Augsburg Confession in Poland - wikt:deaconic - seems to be a real word Strickesel (talk)
- 1 - Evangelical Church of the Augsburg Confession in Slovakia - wikt:seniorats - unsure if ok Strickesel (talk)
- 1 - Even Sapir - wikt:repatriants - seems to be a real word Strickesel (talk)
- 1 - Evening Telegraph (Dublin) - wikt:unavowedly - a real word Strickesel (talk)
- 1 - Evergreen State College - wikt:demeters - probably okay Strickesel (talk)
- 3 - Evolution Theory (Modestep album) - wikt:xKore, wikt:xKore, wikt:xKore - name of a musician (I think) Strickesel (talk)
- 1 - Ewen McQueen - wikt:renewnz - the name of a blogging website Strickesel (talk)
- 1 - Ex-Cubs Factor - wikt:cubness - seems to be okay Strickesel (talk)
- 2 - Excideuil - wikt:ialo, wikt:francicarum - celtic; latin Strickesel (talk)
- 1 - Excited and Scared - wikt:how's - show's Strickesel (talk)
- 2 - Exergonic process - wikt:ergonic, wikt:endergon - suffix; seems to be okay Strickesel (talk)
- 3 - Exhibition of Australian Art in London - wikt:it's, wikt:how's, wikt:airists - piquenit's; show's; apparantly a real word Strickesel (talk)
- 1 - Existenz - wikt:transCendenZ - a video game in this game Strickesel (talk)
- 1 - Exocarpos aphyllus - wikt:dtulya - noongar, indigenous australian Strickesel (talk) // iso code nys --Xurizuri (talk) 09:26, 31 January 2021 (UTC)
- 1 - Exodus of Kashmiri Hindus - wikt:khatrey - some kind of indian Strickesel (talk)
- 1 - Exomilus pentagonalis - wikt:excavately - might be okay Strickesel (talk)
- 1 - Exomilus telescopialis - wikt:excavately - might be okay Strickesel (talk)
- 1 - Exotic felids as pets - wikt:caracats - a species name Strickesel (talk) // more specifically, caracats are crossbreeds between caracals (wild) and Abyssinians (domesticated). It's not mentioned in either of those articles, or I'd suggest making a redirect. --Xurizuri (talk) 09:48, 21 January 2021 (UTC)
- 1 - ExpanDrive - wikt:hubiC - a brand name Strickesel (talk)
- 1 - Exploration Systems Architecture Study - wikt:hypergolics - seems to be a real word Strickesel (talk)
- 1 - Exponential random graph models - wikt:undyadic - don't know enough about this to know if ok Strickesel (talk)
- 4 - Extended metaphor - wikt:pataphors, wikt:pataphors, wikt:pataphors, wikt:pataphorical - an "unusually extended metaphor" Strickesel (talk)
- 2 - Extreme Rules (2009) - wikt:how's, wikt:superplexed - show's; a wrestling maneuver with a link Strickesel (talk)
- 1 - EyeToy: AntiGrav - wikt:thonerers - a species in this series Strickesel (talk)
- 1 - Eyes Wide Open (book) - wikt:globaltl - a hashtag Strickesel (talk)
- 1 - Eysturoy - wikt:estroi - pronounciation of this article Strickesel (talk)
- 2 - Ezboard - wikt:ezboards, wikt:ezboards - the same as the name of this article Strickesel (talk)
- 1 - Ezili Dantor - wikt:insurrected - can't decide if this is okay or not Strickesel (talk)
- 2 - Ezo red fox - wikt:kimotpe, wikt:hurep - words in the language of the ainu, a group in northern japan Strickesel (talk)
- 1 - Ezutromid - wikt:nmDMD - seems to be an illness Strickesel (talk)
El-Er
[edit]- 1 - Eli Waldron - wikt:unanthologized - OK: the meaning is specific and clear, not in dictionary but it is used elsewhere --Stellar 09:45, 27 April 2020 (UTC)
- 1 - Emily Farnham - wikt:cashpiels: an event in the sport of curling. Ira Leviton (talk) 15:26, 25 April 2020 (UTC)
Case notes (E) for T1 from 2018-11-01 dump
[edit]- 2 - E (Epik High album) - wikt:nergy, wikt:nergy: as [e]nergy, the second side of the album.
- 1 - E (novel) - wikt:twatter: a word used in the novel to describe one of the characters, and correspondingly used in the article. I was thinking of deleting it because it's hard to figure out the meaning without context. // I've asked for clarification. --Xurizuri (talk) 08:59, 22 January 2021 (UTC)
- 1 - ENC Press - wikt:everance: title of a book, $everance.
- 1 - Earthsea (universe) - wikt:otaks: fictional character in the book (plural).
- 1 - East Bakersfield - wikt:deincorporated: dissolved as a corporation or city. Legit.
- 1 - East Kilbride Pirates - wikt:unkitted: I'm not sure, may be legit.
- 1 - Eastern Air Lines Flight 605 - wikt:unporting: disengagement of two pieces that go together, as in machinery or aviation.
- 42 - Ego Trip's The (White) Rapper Show - wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock, wikt:hamrock: written as $hamrock.
- 1 - Eldad and Medad - wikt:daddu: translation of a corrupted Hebrew word for "beloved".
- 1 - Electrical substation - wikt:buswork: legit. Sometimes simply called "bus". A conductor, or group of conductors, that serve as a common connection for two or more electrical circuits. In powerplants, buswork comprises the three rigid single-phase connectors that interconnect the generator and the step-up transformers.
- 4 - Electrodialysis - wikt:diluate, wikt:diluate, wikt:diluate, wikt:diluate: probably legit. A chemical term. Akin to concentrate (noun). \\ it's similar to the solute/solvent situation, with diluate and diluent respectively. [1] --Xurizuri (talk) 10:41, 21 January 2021 (UTC)
- 2 - Electropalatography - wikt:electropalates, wikt:electropalate: legitimate, in the context of the page.
- 2 - Elemene - wikt:elemenes, wikt:elemenes: plural of the subject of the page.
- 2 - Elemental: Fallen Enchantress - wikt:gildar, wikt:gildar: the unit of currency used in the game.
- 1 - Elemental: War of Magic - wikt:gildar: ditto.
- 1 - Eliza Acton - wikt:sparghetti: a deliberate misspelling of spaghetti.
- 1 - Eliza Courtney - wikt:sequested: I don't have access to the source and I'm not sure whether it was intentionally spelled this way as an old-fashioned spelling, or a typo.
- 1 - Elk - wikt:waapiti: the Shawnee and Cree spelling of wapiti,.
- 1 - Elmo (shogi engine) - wikt:ponanza: a name for a type of software.
- 2 - Els Catarres - wikt:xoni, wikt:xoni a young person in Catalunya who is culturally Castilian.
- 1 - Elven Star - wikt:tytans: a type of creature in the book.
- 2 - Emblem of the Uzbek Soviet Socialist Republic - wikt:uracle, wikt:uracle: a type of sickle.
- 3 - Emergence (Star Trek: The Next Generation) - wikt:vertion, wikt:vertion, wikt:vertion: a type of particle on Star Trek.
- 1 - Emilio Pujol - wikt:portrs: an abbreviation. (Portraits?)
- 1 - Empress Dowager Xiaochun - wikt:pitian: part of a Chinese title. Possibly should be capitalized.
- 1 - Enclosure Services Interface - wikt:deasserts: computer software jargon.
- 1 - Endodontic files and reamers - wikt:ledging: dental jargon.
- 1 - English Springer Spaniel - wikt:hupped: past tense of 'hup', a command given to a dog.
- 1 - English overseas possessions in the Wars of the Three Kingdoms - wikt:embezeled: a spelling from the 1600s.
- 1 - Environmental movement in the United States - wikt:antitoxics: subgroups that are affiliated with the environmental movement in the U.S.
- 1 - Epilepsy surgery - wikt:resective: a bit of medical jargon, referring to surgery that results in resection, cutting away, or removal.
- 1 - Erin Gee (artist) - wikt:sooe: in the title of an artwork (with a lower case s as written).
- 1 - Eritrean literature - wikt:melkes: plural for melke, an Eritrean word for a work written for funerals and praising the deceased
- 1 - Ernest Maddox - wikt:phorias: plural. Misalignment of the eyes that appears when binocular viewing is broken.
- 1 - Etu - wikt:sekas - non-English. Meaning something like 'referee' Asked for language on talk page. Don't want to assume Indonesian just because that's where the article's subject is practiced. Elfabet (talk)
- 1 - Eulalia Abaitua Allende-Salazar - wikt:dispens: seems to be part of her husband's name, not capitalized in non-wiki source that I could find
- 1 - Euprenolepis - wikt:mandalus: zoology term
- 1 - Eupterote orientalis - wikt:aenescent: entomology term
- 1 - Exaptation - wikt:exapting - likely belongs, perhaps as 'exaptating' (cross of ex- and -adapting). Form of article's subject. Similar forms exist on wikt: e.g. wikt:exaptation. -Can confirm this is a real thing Carla.Abra (talk)
- 1 - Exit (system call) - wikt:movl: part of sample code